1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reptile [31]
3 years ago
13

Help Please!!!!!!

Biology
1 answer:
Goryan [66]3 years ago
5 0
No it is not possible
You might be interested in
What is the boiling point of tap water with 3 tablespoons of table salt in it?
user100 [1]
It would be 200 degrees Celsius
7 0
3 years ago
Read 2 more answers
HELP ASAP!!!! If we don’t do something soon, there will be more plastic than fish in the oceans. How do you suggest we solve thi
Goshia [24]

Creating awareness will always be a solution , but doing something about it creates improvement to the global issue . You can create biodegradable plastics so whenever the biodegradable plastic hits the ocean , the object can become food for the ocean animals instead of harming them ......some McDonald’s are now changing their straws (biodegradable straws ) so change is happening slowly we just need awareness

7 0
3 years ago
why are electron carriers needed for transporting electrons from one part of the chloroplast to another?
svp [43]
High energy electrons are highly reactive (Their energy can be used to make NADPH & ATP.)
5 0
3 years ago
Read 2 more answers
How does algae reproduce? Select the best answer.
Lynna [10]

b. both sexually and asexually

6 0
2 years ago
Why do you think scientists track the genes of other organisms such as rats or mice in the database? Do you think rat genes are
DENIUS [597]

Explanation:

Understanding through into genetic risk factors for various illnesses in the human population come from mouse research. Manipulation of the mouse genome is quite simple, for example, adding or deleting genes to better understand their function in the body.

The majority of mice and rats used throughout medical studies are inbred, which means they are genetically virtually similar, making the outcomes of medical trials more consistent.

6 0
3 years ago
Other questions:
  • What is ecological succession?
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Through which of the following processes is carbon removed from the atmosphere? decomposition of organic waste, burning of fossi
    10·2 answers
  • A beetle from a foreign country enters New York's Central Park. As a result, one of the tree species becomes ravaged by the beet
    7·2 answers
  • The portion of the pericardium that covers the heart wall is called the ________.
    11·1 answer
  • This is a genotype or phenotype: height-short
    11·2 answers
  • Which procedure would increase the validity of the conclusions from this experiment?
    6·2 answers
  • What are sunspots? Pls help
    11·1 answer
  • 2 Points
    5·2 answers
  • What is a hypothesis?????​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!