1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wlad13 [49]
2 years ago
15

Cholesterol belongs to the group of lipids called _____.

Biology
2 answers:
ratelena [41]2 years ago
7 0
The answer is c steroids.
Elan Coil [88]2 years ago
5 0

Answer: c. steroids

Explanation:

Cholesterol is a long chain polycyclic alcohol, considered a steroid, found in cell membranes and transported in the blood plasma of animals.  It is the main sterol synthesized in animal tissue. Cholesterol is excreted through bile acids as salts to the intestine. Free cholesterol can also be released with bile and most of this cholesterol is reabsorbed in the intestines, returning to circulation, returning to the liver.

Cholesterol esters are more hydrophobic than free cholesterol and are transported in the blood via lipoproteins, mainly by LDL and to a lesser extent by HDL and VLDV.

You might be interested in
List at least two types of pollution caused by built environments
lana66690 [7]
Pollution is the introduction of contaminants into the natural environment that cause adverse change. Pollution can take the form of chemical substances or energy, such as noise, heat or light. Pollutants, the components of pollution, can be either foreign substances/energies or naturally occurring contaminants. Pollution is often classed as point source or nonpoint source pollution.

Hope this helps :p
7 0
2 years ago
What is the typical order in which insects begin to arrive on human remains?
Vinil7 [7]
The typical order in which insects begin to arrive on human remains is blowflies, beetles, maggots, wasps, ants, and spiders. I hope that this is the answer that you were looking for and it has helped you. Have a nice day.
5 0
2 years ago
17. A place where two tectonic plates collide is called a ______ boundary and is often associated with _____ faults. ​
NNADVOKAT [17]
Convergent is the first blank i don’t know the second i’m sorry.
4 0
3 years ago
A science student makes the following statement. A raccoon may live longer when it eats only vegetables. What is the student doi
Elena-2011 [213]
The student is likely engaging or forming a hypothesis in which a hypothesis is a scientific method of having to formulate an intelligent or educated guess that may be an answer as to how a problem has occurred in which the student thinks that the racoon may live longer if it only eats vegetables.
3 0
2 years ago
Cellulose belongs to a group of molecules called what
vovikov84 [41]
Polysaccharides
Hope that helps!
6 0
2 years ago
Other questions:
  • Mutations _____.
    5·1 answer
  • What is earth made up of???
    14·1 answer
  • Which term means the release of a tendon from adhesions?
    9·1 answer
  • Please explain why you are alive and your chair is not alive
    8·1 answer
  • Which of the following is not a method of disposing hazardous wastes?
    15·1 answer
  • Which three species will affect plants that grow rich in nitrates like broccoli or corn to grow: is it Pseudomonas Aeruginosa, E
    12·1 answer
  • __________ enter the lymph and need transport carriers to circulate in the bloodstream.
    8·2 answers
  • Why do you think level nutrient-rich and deep soils are optimal conditions for Beta vulgaris
    6·1 answer
  • During what phase is the chromosomes number reduced from 2n to n?
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!