1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
5

Which statement about natural selection is true?

Biology
2 answers:
NISA [10]3 years ago
5 0

Answer:

Explanation:

Environmental changes determine which animals survive

I hope it helps ...Nah?

kenny6666 [7]3 years ago
3 0

Answer:

B. Environmental changes drive differential reproduction

Explanation:

Can I have a thanks, 5 star and brainliest? Also tell me if i am right!!!

You might be interested in
The potato placed in vinegar produced _________.
anastassius [24]

Answer:

Most living tissue contains catalase. We can use potatoes to help see catalase work because bubbles of oxygen form when we put potatoes into hydrogen peroxide.

Explanation:

As catalase decomposes hydrogen peroxide into water and oxygen gas, bubbles of oxygen collect on the disk. When the density of the combined paper/enzyme/O2 is less than the solution the disc will rise to the surface.

3 0
3 years ago
Remember that the glomerulus is the initial filtering sieve of the nephron.
Mars2501 [29]
Filtration rate = 125 mL/minute = 0.125 L/min
Minutes in a day = 24 hours x 60 minutes per hour
Minutes in a day = 1440 
Total filtrate per day = 0.125 x 1440 = 180 L

Number of 2 L bottles to be filled = 180 / 2
= 90 bottles

This value is very large and we do not produce this much urine in a day. This means a portion of the fluid is being reabsorbed.

Absorption.
<span />
8 0
3 years ago
What makes proteins
FrozenT [24]
<span><span>Nucleus-Controls most cell processes and contain the hereditary information of DNA
</span><span>Chromosomes-Small particles made of RNA; assemble proteins
</span><span>
Rough cytoplasmic reticulum-Involved in the synthesis of proteins; has ribosomes attached to its surface


Love,
Makwilson
</span></span>
<span>{ Rank: <span>Virtuoso }</span></span>
8 0
3 years ago
If you are good with science please help me!!! 15p
Elena-2011 [213]

help with what? there is nothing to answer



6 0
4 years ago
Ralph is always thirsty and recently learned that he synthesizes mutated antidiuretic hormone (ADH). Discuss why Ralph would be
Varvara68 [4.7K]

Diabetes insipidus is a disease characterized by excessive thirst and the excretion of large amounts of highly diluted urine, which can not be reduced by a reduction in fluid intake.

Diabetes insipidus is due to a deficiency of antidiuretic hormone or insensitivity of the kidneys to this hormone. This hormone causes water reabsorption via action on the distal segment of the nephron during dehydration.

3 0
3 years ago
Other questions:
  • Molecules "pumped" in or out from low to high concentration:
    11·1 answer
  • Which would be least helpful in reducing indoor pollution? (apex)
    5·2 answers
  • Hurry please!!!
    7·2 answers
  • What compound could serve as the repressor of the trp operon in<br> e. coli?
    10·1 answer
  • Which two substances bind using a lock-and-key mechanism?
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • through which microscopes were cells first observed? simple microscope, tunneling microscope, compound light microscope, electro
    5·2 answers
  • O que é teoria panspermia?​
    9·1 answer
  • True or False: The vast majority of creatures that have ever lived are not
    12·1 answer
  • What are the cons of fetal stem cells
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!