Ask question

Ask question

All categories

3 years ago

14

PLEASE HELP HURRY 25PTS

1 answer:

NikAS [45]3 years ago

4 0

<h2>Answer:</h2>

<u>B. Spores</u> are involved in both sexual and asexual reproduction.

<h2>Explanation:</h2>

In science, a spore is a unit of sexual as well as asexual proliferation that might be adjusted for dispersal and for endurance, frequently for expanded timeframes, in troublesome conditions.

Bacterial spores are not part of a sexual cycle but rather are safe structures utilized for endurance under horrible conditions. Under good conditions, the spore can form into another living being utilizing mitotic division, delivering a multicellular gametophyte, which inevitably proceeds to create gametes.

You might be interested in

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

Worth branliest only if u get it right please answer properly and not just for points it’s the last question for this homework

serg [7]

Deer is the answer, it is quick and has camouflage

8 0

2 years ago

Read 2 more answers

Some countries in Africa have a negative human population growth. This is most likely due to _____.

Vikki [24]

Reductions in the infant mortality

5 0

2 years ago

Read 2 more answers

Which organism is responsible for the production of fermented dairy products, such as yogurt and cheese?

jeka57 [31]

A specific group of bacteria called the lactic acid bacteria (Lactobacillus species) that produces lactic acid as they grow.

7 0

3 years ago

Using the diagram, which of the structures is the oldest?<br><br> H<br> F<br> M<br> B

Anna35 [415]

I would say B so yea...hope ur day doing well

6 0

2 years ago