1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
3 years ago
7

Estimate the widths of three molecules, napthalene, fluorescein, and texas red

Biology
1 answer:
Anastaziya [24]3 years ago
3 0
Eight inches four inches and eighteen inches
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A valley is noticeably lower than the surrounding area. What is one way a valley might form?
ratelena [41]
Though erosion due to water
4 0
3 years ago
Read 2 more answers
2. A mutation is any change in the DNA of a gene.
givi [52]
D) a change in protein synthesis
3 0
2 years ago
Read 2 more answers
When writing a binomial name, it is usually entirely
worty [1.4K]
Yes it is it usually
entirely
6 0
3 years ago
The atomic number of an element is the same as the number of _________ in each atom.
muminat
Neutrons plus protons
4 0
3 years ago
Other questions:
  • .   Which variable stars have pulsation periods between 1.5 hours and 1.2 days? 
    14·2 answers
  • A Hertzsprung-Russell diagram is provided.
    7·1 answer
  • What is a proposed explanation that can be tested
    5·2 answers
  • Which of the following is most often associated with centripetal
    6·1 answer
  • Put the stages of cell cycle in order help
    6·1 answer
  • Create the complementary DNA strand: CTA GTT ACG GTC AAG
    12·1 answer
  • Help please don't know the answer​
    9·2 answers
  • Please help!
    6·1 answer
  • One way to determine the density of animals in an area is to use the mark-recapture technique. A number of individuals from a po
    14·1 answer
  • Which of these things will most likely increase the salinity of a region of the ocean?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!