1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
12

Missy spencer was given penicillin for tonsillitis. she developed a severe life-threatening allergic (hypersensitivity) reaction

to the penicillin. her medical file records this reaction as a(n):
Biology
1 answer:
KatRina [158]3 years ago
5 0

The reaction of which Missy has experience that is a severe and life threatening allergic reaction due to penicillin is anaphylactic reaction, it could be classified as the a serious and life threatening in terms of having allergic reaction for if not treated immediately, it could cause death to the individual who has experience this reaction. This could be triggered from either medications, food in which an individual has consumed and insect stings such as from bees. Missy’s allergic reaction must have triggered because of the penicillin that she has consumed where in, she does not know that she is allergic to the medication, having her to experience a life threatening allergic reaction to the penicillin.

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Why should you always keep materials at least 6 inches inside the edge of a
VashaNatasha [74]
The answer is D hope this helps
3 0
2 years ago
Read 2 more answers
Explain why nonpoint source pollution is a greater threat and hazard than point source pollution
balu736 [363]
Non point source pollution is a greater threat than point source pollution because non point source pollution disrupts the water cycle. 

7 0
3 years ago
The following question refers to the excerpt from Black Boy by Richard Wright.
tresset_1 [31]
He offered him a chance to learn how to write. :3 Hope this helped
4 0
3 years ago
PLSSSS PLSS HELP ME PLSSS WITH THIS QUESTION I WILL MARK U!!!
Mekhanik [1.2K]

It wont let me see the pic

Explanation:

6 0
2 years ago
Other questions:
  • What are the roles of consumers? Check all that apply.
    15·2 answers
  • Plants release water into the atmosphere process called----
    5·1 answer
  • Mucus in the lungs performs a function most similar to:
    13·1 answer
  • What are the four bases found in RNA?
    12·2 answers
  • The hydrolysis of GTP to GDP carried out by tubulin molecules Group of answer choices provides the energy needed for tubulin to
    10·1 answer
  • What is the smallest working unit of living things?
    13·1 answer
  • What molecule in the equation is a hydrcarbon?
    14·1 answer
  • Hypercholesterolemia causes
    8·2 answers
  • Which statement is true about the effect of red tide or algal bloom on the ecosystem?
    5·1 answer
  • Whal is the name for the negative subalomic particles in an atom?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!