1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
3 years ago
11

The part of the endocrine system that regulates the level of sugar in the blood is the _____.

Biology
2 answers:
maksim [4K]3 years ago
7 0
<span>Pancreas. The pancreas does so by having beta cells that secrete a certain amount of insulin after consumption of food. There are then delta cells that regulate the beta cells, and then gamma cells that in turn regulate the delta cells.</span>
dusya [7]3 years ago
6 0

Answer:

hypothalamus

Explanation:

You might be interested in
What does the ocular lens do in the compound microscope
Gnesinka [82]
The ocular<span>, or eyepiece </span>lens<span> that one looks into.</span>
6 0
3 years ago
Read 2 more answers
I need help with the stuff in the pictures ;-;
Sergeu [11.5K]
I see pictures above , what do you exactly need help with?
5 0
2 years ago
Read 2 more answers
Select the correct answer.
blondinia [14]

Answer:

c

Explanation:

troposhere bc tropical

8 0
3 years ago
Read 2 more answers
A cell undergoes cytokinesis after meiosis I. What step happens next
algol [13]

Answer:

prophase 2

Explanation:

7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • What is the result when DNA ligase has completed its job?
    8·2 answers
  • What is the result if a white individual is crossed with a bluish gray individual?
    14·1 answer
  • In order to initiate protein synthesis, what conditions must be met? i. The promoter in the mRNA must be accessible ii. The Shin
    12·1 answer
  • Which reaction is endergonic?
    10·1 answer
  • Which of the following statements is true about the scientific process?
    12·1 answer
  • Which of the following statements is true? Viruses do not cause communicable diseases. Vaccines are 100 percent effective in pre
    15·2 answers
  • The final electron acceptor in aerobic respiration is A) ATP. B) NADPH. C) oxygen. D) water.
    7·2 answers
  • What is Deamination_
    9·1 answer
  • Which statement regarding these methods of reproduction is correct?
    12·1 answer
  • Water is transpired through stomata, but carbon dioxide also must pass through stomata into a leaf for photosynthesis to occur.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!