1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
4 years ago
14

What general statement can be made concerning volcanic eruption & the presence of earthquake activity?

Biology
1 answer:
shepuryov [24]4 years ago
5 0
<span>The general statement which can be made concerning volcanic eruptions and the presence of earthquake activity, is that based upon plate tectonics, which is the theory that individual plates which vary in size move across the earth surface, can lead to volcanic eruptions. Volcanism is associated with both convergent and divergent margin plate boundary types.</span>
You might be interested in
It only takes a few systems working to achieve homeostasis of a healthy body so not 10 organ systems are always ON. This is True
Hunter-Best [27]

Answer:

false

Explanation:

you need all of the organs to achieve homeostasis of a healthy body

8 0
3 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
name any five flowers produced from the cutting techniques. give reason why this technique is useful​
valentinak56 [21]

Explanation:

What are the techniques of cutting flowers?

Custom-cutting the flower stem in open air and immediately placing it in the vase of water is usually fine. Cut all flowers and foliage about one inch from the bottom of a main stem. Make the slice at an angle of about 45 degrees. Cutting at an angle provides a larger exposed area for the uptake of water

6 0
3 years ago
What type of volcano is commonly found in the Pacific Ring of Fire?
a_sh-v [17]

Answer:

Hope it helps!

Explanation:

D - Shield Volcano

7 0
3 years ago
Read 2 more answers
I know lots of things but I like to make sure if it is right sometimes so that it is right
Aleksandr-060686 [28]
Thats a very smart decison good on you!
4 0
3 years ago
Other questions:
  • Which of the following shows the levels of organization in the human body from the smallest unit to largest unit?
    7·1 answer
  • Which correctly describes how the graph of the inequality -4y - x _ 7 is shaded?
    8·2 answers
  • Why does the dna double helix have a uniform diameter?
    13·1 answer
  • What is in the retina in a cows eye
    11·1 answer
  • Organic compounds consisting of various compounds of sugar are generally called
    15·1 answer
  • Describe the flow of energy through living things.​
    5·1 answer
  • Helppppppppppppppppppppppppppppp
    6·1 answer
  • Please help I would really appreciate it
    7·1 answer
  • What is the circulatory Systems function 
    7·2 answers
  • The trapezius is a(n) _____ to the pectoralis major.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!