1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
6

AUUUAACUGUUCUGUCUAGAG

Biology
1 answer:
Lana71 [14]3 years ago
5 0

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

You might be interested in
Who is the theorist who linked intelligence and school success in constructing an intelligence test that continues to provide re
Natalka [10]

Answer: I want to believe the question is asking for the psychologist that linked intelligence and school success. The name of the psychologist is Alfred Binet.

Explanation: Alfred Binet was a French psychologist alongside Theodore Simon developed a test (Binet-Simon intelligence scale) to measure the intellectual skills of French schoolchildren in 1904. Binet equated intelligence with common sense and he defined it as the faculty of adapting to a particular situation. The Binet-Simon test focused on memory and attention and it was developed in other to help identify French schoolchildren with learning disabilities.

The test was later revised by psychologist Lewis Terman and became known as the Stanford-Binet

6 0
4 years ago
What modifications of cellular respiration might you find in dormant seeds?
tia_tia [17]
During dormancy, seeds wait until the conditions are optimal for cellular respiration. Modifications would include things such as seeding elongation, germination and hormone regulation
6 0
3 years ago
Read 2 more answers
Deforestation will most directly result in an immediate increase in
34kurt
Probably deserts or plains... are there answer choices ? if there are can you add them in the comments :)
7 0
4 years ago
Read 2 more answers
Which of the following genotypes could be described as homozygous dominant​
ipn [44]

Answer:

Homozygous dominant genotype means both the alleles ( alternative form of a gene) are same. ... AA shows that both the alleles are same and are dominant

Explanation:

6 0
4 years ago
An electron microscope is very powerful and allows you to see very tiny, thin specimens.
Pavel [41]
Please provide an actual question. Thank you!
7 0
3 years ago
Other questions:
  • Mitochondria are thought to be the descendants of certain alpha proteobacteria. They are, however, no longer able to lead indepe
    7·1 answer
  • An experiment was conducted by Diane Dodd in which a single population of fruit flies was divided into two, with one of the popu
    6·1 answer
  • During meiosis, a defect occurs in a cell that results in the failure of microtubules, spindle fibers, to bind at the kinetochor
    8·1 answer
  • 2. Think about an animal like a rhinoceros, a deer, or an antelope. What parts of their body other than their hair must be compo
    10·1 answer
  • Organism that can that can breed/produce fertile offspring_________
    6·1 answer
  • How are matter and energy transformed during photosynthesis? Be sure to address carbon and chemical energy in your answer.
    8·2 answers
  • The National Cancer Institute is not regulated by the government.<br><br> True<br> False
    13·2 answers
  • As you walk down the hall on the way to class, several students sneeze. You unknowingly inhale some of the droplets
    13·1 answer
  • What substances can get through the membrane? What type of transport is this?
    15·1 answer
  • Identify the phases in cells 2, 12, 29, 32, and 41 in the image below.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!