1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
6

AUUUAACUGUUCUGUCUAGAG

Biology
1 answer:
Lana71 [14]3 years ago
5 0

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

You might be interested in
If you develop a particular flower which cannot be reproduced from seeds, it could be preserved by grafting.
RideAnS [48]
True is the correct answer to your answer.
5 0
4 years ago
The actual exchange of gas occurs at the
Lelechka [254]

Answer:

gas station, or butt

Explanation:

the gas station can fill your car and exchange gas with the pump. when you fart you exchange gas with the air.

6 0
3 years ago
Electricity is added to recharge a battery. What is added to ADP to form ATP?
White raven [17]

Electricity is added to recharge a battery. A third phosphate group  is added to ADP to form ATP.

ATP or Adenosine triphosphate contains adenine, ribose and 3 phosphate groups.

ADP is converted to ATP by the following reaction:

ADP+Pi+energy⇄ATP

The analogy between battery and ATP can be explained as ATP is higher energy form and ADP is lower energy form like charged and uncharged form of the battery. When the terminal or third phosphate is removed from the ATP it becomes ADP and releases energy like a battery. The additional phosphate group when added to ADP forms the ATP molecule like the energy spent by the batteries are recharged by putting in additional energy. Here the additional energy is provided by the third phosphate group.

6 0
4 years ago
Read 2 more answers
Why have plants evolved ways to prevent self-fertlization? Why do you cross-fertilization (plant to plant) more beneficial to th
raketka [301]
2) Cross-fertilization makes for more variation in the traits of plants, giving them immunities and resistances to weather, pests, and disease.
6 0
4 years ago
What breed of dog is in the claritin commercial with the man laying in tbe grass?
velikii [3]

In the Claritin commercial, the man is laying in the grass with a beagle puppy. The beagle is a breed of small hound that is similar to a larger foxhound that has approximately 220 million scent receptors. This is the reason why they are employed as detection dog and not as guard dogs for they are usually friendly dogs.

 

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following do ALL living things have in common
    5·1 answer
  • What are the seed leaves that provide energy for young seedlings of angiosperms called?
    8·1 answer
  • What biological molecule could best be described as fuel and building material?
    14·1 answer
  • In a population with 2 alleles for a particular locus (D and d), the frequency of the D allele is 0.75.
    6·1 answer
  • Why do mosquitos need warm temperatures?
    12·2 answers
  • If the results of an experiment disprove the hypothesis, the test was poorly designed and is invalid.
    9·1 answer
  • The model illustrates a process by which a substance is taken up by a cell. Which statements describe the process? Select the co
    13·1 answer
  • Individuals in a population do not have variable
    5·1 answer
  • What stage of mitosis is depicted in the diagram below ?
    11·1 answer
  • What are the two reasons why viruses have such small genomes. (Select both correct options) Viruses have fewer genes than living
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!