1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
6

AUUUAACUGUUCUGUCUAGAG

Biology
1 answer:
Lana71 [14]3 years ago
5 0

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

You might be interested in
Help me first please!!!!
sukhopar [10]

Whats wha t do hoy mean

7 0
3 years ago
Whose experiment showed how enzymes could have formed inorganically?
Inessa05 [86]
Stanley Miller showed how enzymes could have formed inorganically.
8 0
3 years ago
Read 2 more answers
Discuss the purpose of guard cells and stomata on the leaves of plants.​
BabaBlast [244]
Guard cells are located in the leaf epidermis and pairs of guard cells surround and form stomatal pores, which regulate CO2 influx from the atmosphere into the leaves for photosynthetic carbon fixation.

Stomatal guard cells also regulate water loss of plants via transpiration to the atmosphere.
5 0
3 years ago
Wind is considered to be an abiotic becomes it
Varvara68 [4.7K]
Wind is considered to be a biotic factor.
4 0
3 years ago
Which organism is able to cause an Infection​
Nimfa-mama [501]

Answer: A variety of <u>microorganisms</u> can cause disease. Pathogenic organisms are of five main types: <u>viruses, bacteria, fungi, protozoa, and worms.</u> Some common pathogens in each group are listed in the column on the right. <u>Infectious agents can grow in various body compartments, as shown schematically in Fig.</u>

I hope this helps :D

Please make it the brainliest I tried my best

8 0
4 years ago
Read 2 more answers
Other questions:
  • Does anyone know about "Van der Waals forces" I know it's "intermolecular forces of attraction" And they hold molecules together
    10·1 answer
  • Jonathan sows some pea seeds in one pot within few days the seeds germinate and a radicle forms which gives rise to roots how do
    13·1 answer
  • Suppose an alkane had 8 carbon atoms. How many hydrogen atoms would it have? a. 18 atoms c. 10 atoms b. 16 atoms d. 12 atoms
    13·2 answers
  • What structure exits the pelvis inferior the piriformis muscle?
    8·1 answer
  • Are viruses considered nonliving because they're are not made of protein
    11·1 answer
  • When compounds that are formed from ionic bonds decompose, the products are usually _____.
    8·1 answer
  • Similarities between heterozygous and homozygous genotypes?
    13·1 answer
  • Someone who has the blood type AB had parents with _____ genes.
    12·2 answers
  • What is sexual reproduction?<br>​
    10·1 answer
  • Why is it important to look for solutions to rising CO2 levels now, vs. waiting until later? Which generations (now vs. future)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!