1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
3 years ago
5

Red and green beetles from a forest migrate to grasslands.In the new environment,green beetles are able to protect themselves be

tter from predators through camouflage.Which change in the population will most likely happen over time?
Biology
2 answers:
FromTheMoon [43]3 years ago
8 0

Answer:

The green beetle will survive because of its natural comflauge as the red beetle will slowly decrease becuase of its non camouflauge

Explanation:

Plz mark as brainliest

Margarita [4]3 years ago
4 0
The population of red beetles will more likely to decrease over time, meanwhile the green beetles may increase. This is because in a new environment, red beetles are more likely to be found by predators, and green ones can camouflage themselves, so the red ones will be eaten, while the green ones stay unbothered so that the rate will even increase
You might be interested in
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
2 years ago
Describe the position of the frog when it is floating
Illusion [34]

Answer: It would be on its stomach with its legs bent and its arms in front of it. It would blend into the brown color of the water.

Explanation:

6 0
2 years ago
Will give brainliest How would this change MOST LIKELY affect the various populations over time?
sukhopar [10]

Answer:

i think C but i could be wrong

Explanation:

3 0
3 years ago
The nurse is caring for a 21-year-old female burn victim. her parents ask why their daughter has to be fed by a nasogastric tube
kvv77 [185]
She should state that it is important to get calories into her daughter and that a nasogastric tube will be the best way to do that.
4 0
3 years ago
The blob operon produces enzymes that convert compound A into compound B. The operon is controlled by regulatory gene S. Normall
Hoochie [10]
The blob operon produces enzymes that convert compound A into compound B. The operon is controlled by regulatory gene S. Normally, the enzymes encoded by the operon are synthesized only in the absence of compound B. If gene S is mutated, the enzymes are synthesized in the both the presence AND absence of compound B. Gene S must encode a(n):

a. inducer.
4 0
3 years ago
Other questions:
  • Which answer correctly compares the Krebs cycle and the electron transport chain? (2 points)
    10·1 answer
  • What responses are observed in a person experiencing acidosis, a condition defined by the ph of the blood falling below 7.4?
    11·1 answer
  • Why do think a disposable copy of the DNA code is necessary for protein synthesis
    8·1 answer
  • What is the effect of differential reproduction over time?
    5·2 answers
  • Living plants may be valuable additions to science classrooms. Which is the most important safety consideration when planning to
    7·1 answer
  • Why is water extremely cohesive?
    11·1 answer
  • What is the importance of the large amounts of ribosomes in chloroplasts?
    15·2 answers
  • How does the pleura help with breathing?
    5·1 answer
  • Which statement best describes how the carbon cycle and oxygen cycle are interrelated?
    10·1 answer
  • Technique in molecular genetics permitting the analysis of any short sequence of dna or rna.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!