During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer: It would be on its stomach with its legs bent and its arms in front of it. It would blend into the brown color of the water.
Explanation:
Answer:
i think C but i could be wrong
Explanation:
She should state that it is important to get calories into her daughter and that a nasogastric tube will be the best way to do that.
The blob operon produces enzymes that convert compound A into compound B. The operon is controlled by regulatory gene S. Normally, the enzymes encoded by the operon are synthesized only in the absence of compound B. If gene S is mutated, the enzymes are synthesized in the both the presence AND absence of compound B. Gene S must encode a(n):
a. inducer.