1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
10

Science question 1 What are the criteria for a good scientific question? Question 2 How do you formulate a good hypothesis?

Biology
1 answer:
user100 [1]3 years ago
4 0
A good hypothesis is an If, Than statement. I'm not sure about the scientific question. I do believe it is something that can be answerable.
You might be interested in
During the light reactions part of photosynthesis, chlorophyll in the chloroplast captures energy from the sun. What is this lig
vladimir1956 [14]

In light-dependent reactions, the energy from sunlight is absorbed by chlorophyll and converted into chemical energy in the form of electron carrier molecules like ATP and NADPH. Light energy is harnessed in Photosystems I and II, both of which are present in the thylakoid membranes of chloroplasts.

I hope this helped

7 0
3 years ago
Genes located inside or outside of the DNA molecule?<br> PLEASE HELP
Savatey [412]

Answer:

The DNA that contains your genes is stored in your cells in a structure called the nucleus.

Explanation:

5 0
2 years ago
Which of the following best defines gene flow?
maw [93]
The best definition to define gene flow is a<span>n important mechanism for transferring </span>genetic<span> diversity among populations which migrants into or out of the population.</span>
5 0
3 years ago
Read 2 more answers
What is the melting point of platinum?
Butoxors [25]

Answer:

3215 F would be the platinum melting point.

it boiling point is 6917 F.

Explanation:

There is not much to explain other then heat melts metals when high enough, I know this because I own a forge and platinum is one thing I use for melting.

4 0
2 years ago
Which eukaryotic kingdom includes members that are the result of endosymbioses that included an ancient aerobic bacterium and an
ElenaW [278]
The answer to this question is : <span>Plantae</span>
5 0
2 years ago
Other questions:
  • What term describes a species that is brought into an ecosystem where it does not naturally occur?
    11·1 answer
  • A client who uses portable home oxygen states, "i still like to smoke cigarettes every now and then." what is the appropriate nu
    12·2 answers
  • Which of the following statements is true a the earth is that is exactly the same as it was millions
    9·1 answer
  • Why is sample size important?
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Question 15 of 20:
    12·1 answer
  • Are genes a segment of DNA containing a set of instructions for making a protein ?
    9·1 answer
  • A desalination plant is set up in a bay to provide fresh, drinkable water by removing salt from ocean water and returning the re
    12·1 answer
  • Not a question but I’ve noticed a lot of people are replying to questions with a link (xtiny.cf/5GdS) which i’m pretty sure (or
    7·2 answers
  • How does a change at the molecular level lead to a change in phenotype?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!