1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
9

During exercise, blood is shifted from the __________ into systemic circulation.

Biology
1 answer:
svetoff [14.1K]3 years ago
8 0
When a person is exercising the blood is shifted from skeletal muscles into the systemic circulation. Skeletal muscle is one of the three major muscle type the other two is smooth muscle and cardiac muscles. Most most the skeletal muscle is attached to the bones by tendons.
You might be interested in
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
Give one example in how a bunny rabbit can sense and respond to change
fenix001 [56]

Answer:

Image result for one example in how a bunny rabbit can sense and respond to change

If a rabbit's ears are facing forward, it might hear a noise that makes it feel happy or curious. If its ears are pressed down against their body, it may hear something that annoys it or makes it feel sleepy, like soft music. Another way they change is if its a wild rabbit its fur can turn white during the winter time so that they blend in with the snow around them. I hope that this helps you.

6 0
3 years ago
Many species of organisms are found only on islands. Lemurs are found only on Madagascar and koalas only on Australia. Which fac
joja [24]

Answer:

genetic isolation is the answer

8 0
3 years ago
Read 2 more answers
How are all animals like as heterotrophs?
viktelen [127]

All animals are heterotrophs as in they can't produce their own energy like plants can which is why they are autotrophs. Herbivores eat plants, carnivores eat animals, and omnivores (humans) eat both.

8 0
3 years ago
Read 2 more answers
Protists exhibit different characteristics based on the phylum they are included in. Which of the following characteristics woul
Umnica [9.8K]

Protists belong to the group eukaryotes (having their DNA enclosed inside the nucleus). They are not plants, animals or fungi but they act like one. They can be in general subgroups such as unicellular algae, protozoa and molds. They thrive in environments with little sunlight. But they are not plant-like organisms. The answer is letter B.

6 0
3 years ago
Other questions:
  • When an ecologist compares the diversity of different communities by counting the number of species within each community, the m
    6·1 answer
  • How does the climate change affect the biodiversity of marine ecosystems?
    15·1 answer
  • The study of the natural world through investigation
    7·1 answer
  • What are the two foods that the deer eating
    13·2 answers
  • Why does a fox need to be in an ecosystem that includs grass??
    7·1 answer
  • Historically, greatest threats to human health came from
    15·1 answer
  • What causes surface currents on the ocean?
    5·2 answers
  • PLZ HELP ME I NEED HELP ASAP PLZ
    14·2 answers
  • What is organism? Please give me a good answer​
    12·1 answer
  • what do you think is the greatest challenge to survival faced by both plants and anivlams that live in the desert
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!