1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
4 years ago
14

What flows during gene flow

Biology
2 answers:
Darya [45]4 years ago
6 0

Gene flow is also called gene migration. Gene flow is the transfer of genetic material from one population to another. Gene flow can take place between two populations of the same species through migration, and is mediated by reproduction and vertical gene transfer from parent to offspring.

Orlov [11]4 years ago
6 0

Answer:

Genes.

Explanation:

Gene my be defined as the functional segment of DNA that codes for the particular protein. Gene can be transmitted to the next generation as genes are present on DNA.

Gene flow may be defined as the migration of genes from one place to another. The emigration and immigration allows the exchange of genes between the population. The genes or alleles are transferred in the different population.

Thus, the answer is genes.

You might be interested in
If a plant is composed of cells that contain nuclei are they eukaryotic prokaryotic or multikaryotic?
gavmur [86]

Answer:

The predominantly single-celled organisms of the domains Bacteria and Archaea are classified as prokaryotes (pro– = before; –karyon– = nucleus). Animal cells, plant cells, fungi, and protists are eukaryotes (eu– = true).

Explanation:

3 0
3 years ago
Read 2 more answers
What type of microscope is used for looking at metal surfaces?
KiRa [710]
A metallurgical microscope
8 0
4 years ago
If a cell was to have it's plasma membrane freeze, why would the cell die?
kifflom [539]

Answer:

because it needs its plasma membrane to live and if it freezes then it dies

6 0
4 years ago
Read 2 more answers
This is science PLEAS HELP 15 points PLEASE
Hitman42 [59]

when you put your finger on something hot your nervous system gives your brain a message that tells your brain that that thing is hot and your brain tells you what your touching is hot and then you pull your finger away.

plz give brainlist

6 0
3 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Other questions:
  • If you are good with science please help me!!! 15p
    11·1 answer
  • Describe pioneer species. What types of environments do they like?
    8·1 answer
  • Some single-called organisms make copies of themselves through mitosis. Which describes the function of the cell cycle in such s
    14·1 answer
  • This system receives and transmits information and responses. It depends upon electrical impulses created by the movement of cha
    9·1 answer
  • Your courage zone is composed of things like uncertainty, pressure, change, adventure, and risk.
    8·1 answer
  • Dutch elm disease, which has killed millions of elm trees, is caused by a type of _____ fungus. club sac zygote-forming chytrid
    8·2 answers
  • When Mendel crossed true-breeding tall pea plants with true-breeding short pea plants, all the offspring were tall. Then he allo
    13·1 answer
  • What is thermohaline circulation?
    7·1 answer
  • What are the genotypes of the parents used in the cross shown below?<br> АА<br> Аа<br> Аа<br> аа
    11·2 answers
  • A clownfish attracts prey to an anemone while the anemone provides
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!