1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
7

Please Help, I Will Mark Brainliest

Biology
1 answer:
Crazy boy [7]3 years ago
5 0

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

You might be interested in
Can someone help me in this plz
BigorU [14]
Multiply each number by 2, the numbers on the label say that’s the amount for 10 twists. But the question states that you are consuming 20 so therefore multiply each nutritional factor by 2
7 0
4 years ago
Read 2 more answers
Which statement describes a difference between the lower mantle and oceanic crust? O The lower mantle is closer to Earth's surfa
tatuchka [14]

Explanation:

The difference between the lower mantle and the oceanic crust is first their respective locations, pressure and temperature-- the pressure and temperature increases with depth in the earth this the mantle is more hot and under great pressure than the crust. hope this helps

6 0
3 years ago
Read 2 more answers
How many times more acidic is ph of 3 than ph of 5
GarryVolchara [31]

A pH less than 7 is acidic. A pH greater than 7 is basic. The pH scale is logarithmic and as a result, each whole pH value below 7 is ten times more acidic than the next higher value. For example, pH 4 is ten times more acidic than pH 5 and 100 times (10 times 10) more acidic than pH 6.

6 0
3 years ago
Read 2 more answers
What kind of adaptations could have given homosapiens an evolutionary advantage over neanderthals and other species of humans?
3241004551 [841]

Answer:

humans had more developed 'social' brains than Neanderthals, which enabled us to colonize new habitats and adapt to climate fluctuations

Explanation:

A more developed brain is considered to be an adaptive advantage that enabled early humans to leave Africa and colonize new habitats. Modern humans are able to adjust to new environments, situations, and socialize with other humans because the brain is a social organ. Although Neanderthals were able to occupy an important area of Europe, H. sapiens could colonize faraway lands, migrating into tropical forests, deserts, and glacial lands (colder areas than those colonized by Neanderthals). These early humans formed social groups which enabled them to find food more easily, thus greatly increasing their chances for survival.

3 0
3 years ago
What historical data from Tokyo could have helped in the development of Tokyo’s new flood protection system ?
Mariulka [41]
Data that shows why floods were occurring , how they were occurring so that they could progress and make changes to the issues.
6 0
3 years ago
Read 2 more answers
Other questions:
  • 2. Classify Do all organisms shown in Figure 18-4 that belong to the class Mammalia also belong to the genus Ursus? Explain.
    7·1 answer
  • According to the theory of common descent, species on earth today should:
    11·1 answer
  • After being absorbed, ______ soluble nutrients enter the lymphatic circulation whereas ______ soluble nutrients enter the portal
    12·2 answers
  • What are three major differences between rna and dna?
    6·1 answer
  • What process has led to the development of antibiotic-resistant bacteria?
    15·2 answers
  • a model of pre-mRNA and mature mRNA is shown above. in what types of cells would the mRNA be modeled in manner?
    5·1 answer
  • How have industries used cogeneration and recycling to improve their energy efficiency?
    10·1 answer
  • 1. Do plants, like animals, have traits that increase their reproductive success? What are some of these
    13·1 answer
  • When a cell gets too old and can’t function correctly anymore. We refer to these mechanisms as
    9·2 answers
  • Please answer 16 points !!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!