1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
2 years ago
7

Please Help, I Will Mark Brainliest

Biology
1 answer:
Crazy boy [7]2 years ago
5 0

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

You might be interested in
What is exine is made up of????
Solnce55 [7]

Answer:

sporopollenin

While the exine is composed of sporopollenin, a complex and highly resistant biopolymer containing fatty acids, phenylpropanoids, phenolics and carotenoids, the intine is largely composed of pectin and cellulose.

Explanation:

6 0
3 years ago
Which letter on the diagram below represents the lens of the eye?
eduard

Answer:

B

Explanation:

8 0
3 years ago
Read 2 more answers
Complete the given statement with the most appropriate words.
aliya0001 [1]
Answer #1: instinctual trait
Answer#2: learned trait
6 0
3 years ago
A client visits the primary healthcare provider with severe facial acne. the primary healthcare provider prescribes tretinoin. w
alukav5142 [94]
Tretinoin is a naturally occurring metabolite of retinol in the retinoid class, including natural and synthetic analogues. It is the acid form of vitamin AIt acts on cell growth and differentiation. Its main use is the treatment against acne thanks to its keratolytic and anti-inflammatory properties. Tretinoin is also used in the treatment of acute myeloid leukaemia type 3 (AML 3).

SIDE EFFECTS:
Among the expected effects, side effects may occur. Signs of an allergic reaction include: hives, difficulty breathing, swelling of the face, lips, tongue or throat;

It should be known that tretinoin can make you more sensitive to the sun, so use sunscreen every day, and wear protective clothing outdoors.
Cholesterol and triglycerides should be done before and during treatment because this drug could increase their values
Some patient with leukaemia treated by tretinoin has suffered from The syndrome of retinoic acid which is characterized by fever, dyspnea, acute respiratory distress...
7 0
3 years ago
Examples of short-term, human-induced environmental changes
Drupady [299]
Pollution and deforestation
7 0
2 years ago
Other questions:
  • Rather than take this practice yet again, let's work on one of these problems together. If a fellow student told you, "the human
    13·1 answer
  • All cells have DNA or pther genetic materials . Is this apart of the cell theory or not apart
    13·2 answers
  • One reason farmers might choose non-GM crops over GM crops is because non-GM crops are A. less safe. B. more productive. C. less
    5·2 answers
  • To ensure its survival, any species must be able to
    9·2 answers
  • Which of the following is NOT a type of Devonian arthropod?
    15·1 answer
  • What is an
    9·1 answer
  • Which enzyme attaches the ozaki fragments?
    11·2 answers
  • How could you prevent the contamination of the phosphorus cycle?
    8·1 answer
  • What is an astronomical unit or AU?
    15·1 answer
  • The total number of organisms an ecosystem can support is its tolerance range.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!