Answer:
Hydrogen in the core of the star is converted to helium by nuclear fusion. When the hydrogen supply in the core begins to run out, and the star is no longer generating heat by fusion, the core becomes unstable and contracts.
I would like to guess the answer is distilled water but I'm not positive
Water vapor is important because it is the source of all clouds and precipitation and like carbon dioxide, it is also a heat absorber. Aerosols are important bc many acts as surfaces on which water vapor can condense, an important function in the formation of clouds.
Water vapor, steam, or steam is the gas phase of water. The state of water in the hydrosphere. Water vapor is produced by evaporation or boiling of liquid water or sublimation of ice. Water vapor, like most components of the atmosphere, is transparent. Under typical atmospheric conditions, water vapor is continuously produced by evaporation and removed by condensation. It is less dense than most other components of air and causes convection currents that lead to cloud formation.
As part of the Earth's hydrosphere and the water cycle, it is particularly abundant in the Earth's atmosphere, where it acts as a greenhouse gas and warming feedback, and is a more global gas than non-condensable gases such as carbon dioxide and methane. Contribute to the greenhouse effect. The use of water vapor as steam has been important since the Industrial Revolution as a major component of cooking and power generation and transportation systems.
Learn more about Water vapor here: brainly.com/question/11226635
#SPJ4
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
