1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
4 years ago
11

Describe in detail how gases are exchanged between the respiratory system and the circulatory system in the lungs

Biology
1 answer:
charle [14.2K]4 years ago
4 0

Answer:

Gas exchange

Explanation:

Gas exchange takes place in the millions of alveoli in the lungs and the capillaries that envelop them. As shown below, inhaled oxygen moves from the alveoli to the blood in the capillaries, and carbon dioxide moves from the blood in the capillaries to the air in the alveoli.

You might be interested in
In addition to gas exchange, what is the overall goal of respiration?
tresset_1 [31]

Answer:

The primary function of the respiratory system is to deliver oxygen to the cells of the body's tissues and remove carbon dioxide, a cell waste product. The main structures of the human respiratory system are the nasal cavity, the trachea, and lungs.

Explanation:

Hope this helps:)

5 0
3 years ago
12. Cells can interact with other cells
lina2011 [118]

Answer: True

Explanation: Cell sends and receives signals from each other. This allows for our body to function correctly.  For example your brain cells sends many signals to the rest of the body.

5 0
4 years ago
How does exercise affect the function of each system?​
Ksju [112]

affects Integumentary System by making your body heat up making you sweat

dosent affect skeletal system

dose affect the muscular system by breaking muscle tisues.

dosent affect the nervous system

dosent affect Endocrine System

dose affect cardiovascular system by pumping blood faster getting musles oxygen and getting rid of carbon dioxide

dosent affect the urinary system as water in the system will leave though sweating.

affects the Respiratory System by causing it to breath faster to keep up with the amount of oxygen the body needed.

dose affect the lymphatic system by transporting fluids in the blood stream

extersising a few hours after eating will boost the digestive system eating to soon will result in regurgitation or affect how well you extersise

dose not affect the reproductive system

8 0
4 years ago
Can someone suggest a theme for biochemistry project. I'm in 9 grade (15y old).<br>​
d1i1m1o1n [39]

Answer:

u can do one thing u can have some vegetable peel and then that vegetable u can keep in the soil and with this u have mad homemade fertilizer and can find how it is formed with how many gases and all.

thank you hope it will help u

make me brainlist

8 0
3 years ago
Which of the following is the best way to pick up a small dog that weighs approximately 10 pounds?
blsea [12.9K]
My answer would most likely end up being D.
7 0
3 years ago
Other questions:
  • In the Grand Canyon, the _________ Unconformity occurs wherever Paleozoic layers overlie Precambrian rocks.
    13·2 answers
  • Increased global movement of people decreases the risk of pandemic flu
    11·1 answer
  • Earth receives thermal energy from the sun via radiation. Which of the following is a result of this energy transfer
    12·1 answer
  • If the producers in this aquatic food chain produce 50,000kcal of energy; how much energy would the Perch have?
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • BIOLOGY HELP ASAP PLEASE. THANK YOU AND GOD BLESS
    5·1 answer
  • What effect does planting trees and bushes on a steep hill have?
    12·1 answer
  • Kinetochore microtubules assist in the process of splitting centromeres by _____.
    6·1 answer
  • Most viruses form a capsid around their nucleic acid core. this capsid is composed of?
    15·1 answer
  • (q004) which subfield of biological anthropology uses the fossil record to examine the anatomy and behavior of our relatives in
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!