Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
One is living thins and others are for like other things dna is wat tells the difference between people and stuff and rna don’t idk lol
Answer:
Independent variable
An
independent variable is a condition in a scientific study that is changed or
manipulated to test the effects on the dependent variable. The experimenter
controls the value of independent variable and its value represent inputs or
causes like potential reason for variation.
Additionally, there are
tendencies that independent variables are included in a scientific study especially
if the experimenter has no intention to test their effect directly.
It’s very confusing sorry for that
Answer:
Protista
Explanation:
In biology, there are said to be six different kingdoms that an organism can be classified under. They include Animalia, Plantae, Fungi, Protista, Archaea/Archaebacteria, and Bacteria/Eubacteria.
With this in mind, you say that a unicellular (single-celled) organism without a nucleus was found in pond water. This would point to the Protista kingdom, which are also known as protists. These organisms are single-celled beings with no big nucleus that are typically found in environments like ponds.
Hope this helped! I will take my 100,000 dollars via wire transfer (or just give this answer branliest)
