1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
3 years ago
9

Venus is known for its

Biology
1 answer:
borishaifa [10]3 years ago
3 0
B. thick atmosphere
You can also use quizlet to look up answers also, I'm in college and they have never failed me.
You might be interested in
Please choose the answer that best describes a scientific location for 3,134,000,000
allsm [11]
3.13 x 10 ^9
This is because only 1 number is front of the decimal and 2 numbers should be after
7 0
2 years ago
The measurement of the matter in the universe is called
Free_Kalibri [48]

Answer: mass

Explanation:

6 0
2 years ago
A molecule whose ends have opposite electric charges is called a _____ molecule?
zzz [600]
I think its called a polar molecule
7 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
In the Industrial Age of employment, the role of workers was primarily as
zimovet [89]
I believe it would be manual labor. During the Industrial Age of Employment, most people would have to do repetitive jobs, or manual labor. Design, engineer, and knowledge broker were not common during this time.
7 0
2 years ago
Other questions:
  • What is the main difference between oogenesis and spermatogenesis in terms of meiosis?
    14·1 answer
  • Fatty acid metabolism disorder is an autosomal recessive disorder. Two unaffected parents have 6 children - all of whom are unaf
    7·1 answer
  • Samantha's doctor is concerned that samantha may have a brain tumor. which method of neuroimaging should he use to detect the tu
    7·1 answer
  • How do unicellular organisms move around?
    11·1 answer
  • Which of these best describes the role of helicase and DNA polymerase in DNA replication? *
    13·1 answer
  • 1. According to the graph below, what temperature will result in the highest rate of photosynthesis? A. 5°C
    11·2 answers
  • The interaction of substances A and B is an example of
    5·1 answer
  • Which microscope would be MOST useful for examining the contours of the surface of a bacteria cell?. A)compound light microscope
    7·2 answers
  • How big is the forehead of a chimpanzee
    12·2 answers
  • What format is typically followed with a hypothesis
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!