Through a sequence of steps called the immune response<span>, the </span>immune system<span>attacks these </span>pathogens<span>. ... This is the </span>immune system<span>. Cells. The cells involved are white blood cells (leukocytes), which seek out and destroy disease-causing organisms or substances</span>
Answer:
I'm glad you asked!
Explanation:
The answer is light excites electrons that create a current.The Photo voltaic cell puts the light into a type of electricity and BOOM ,there you have it!
Answer:
a. No discrepancy is present; organisms that contain an outer membrane and periplasmic space should stain pink because of their cell wall composition.
Explanation:
Gram stain is the staining method used to differentiate bacterial species into two groups, gram-positive and gram-negative bacteria. Factors that will differentiate gram-positive from gram-negative include the coloration of bacteria, the composition and chemical and physical properties of cell walls. In these tests, bacteria that have an outer membrane and a periplasmic space are considered gram negative and pink in color (sometimes similar to red) due to their cellular composition. For this reason we can state that there is no discrepancy present in the bacteria exposed in the question; Because this bacterium has an outer membrane and a periplasmic space, then it is normal for the bacteria to turn pink due to its cell wall composition.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Enzymes are in the Proteins class
