1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
14

What makes human dna different from oak tree or frog DNA?

Biology
2 answers:
Monica [59]3 years ago
8 0

Answer:

Nucleotide arrangement

Explanation:

There are obvious differences between humans, oak trees and frogs, but at the molecular level- the cells of all eukaryotes including plants and animals contains DNA in the same shape (double-helical).

All DNA molecule consists of two long polynucleotide chains composed of four types of nucleotide subunits (A, G, C, T). Each of these chains is known as DNA strand. The difference between species lies in the arrangement of the nucleotide bases in the DNA of respective organisms.

The sequence of nucleotides determines which proteins will be synthesized. The way the nucleotides (Adenine, Guanine, Cytosine and Thymine) are arranged determines the information they encode, this information ultimately determines whether the organism will produce scales(frogs), leaves (oak plant) or legs (humans).

lara31 [8.8K]3 years ago
4 0

oak tree DNA is much longer than that in human and the number of chromosomes also differ

You might be interested in
Which of the following kinds of cells perform basic functions such as obtaining energy from food?
kondor19780726 [428]

Answer:

Both plant and animal cells

Explanation:

6 0
3 years ago
Read 2 more answers
Are centrioles affected by viruses
artcher [175]

Answer: Yes they are affected. By targeting the centrosome, some viruses hijack its functions, leading eventually either to cell death or to cell transformation.

Explanation:

5 0
3 years ago
Do all bacteria that grow on blood agar break down the blood
kirza4 [7]
Probably not. some bacteria produce enzymes that break down hemoglobins in RBC.
4 0
3 years ago
Explain the importance of immunological memory cells. Describe in detail how and when memory cells arise and explain how they fo
Vlad1618 [11]

Explanation:

<em>Immunological memory</em> is the property of the immune system to store information about a stimulus so it can mount an effective response if it encounters the same stimulus again being this second response quicker and stronger even after years since the first encounter.

This kind of response is dependent on many subpopulations within T and B lymphocytes and NK cells. When encountering an antigen, B cells recognize it by membrane antibody specifically binding to the antigen and then being activated to expand rapidly with their progeny clones differentiating into plasma and memory B cells, these last ones have a long life span to remain in the body, ready when another encounter with the same stimulus occurs, this is how the basis for effective immunizations happens.

I hope you find this information useful! Good luck!

4 0
4 years ago
What conditions account for the development of highly diverse habitats in coastal waters?
kirza4 [7]
<span>I think for the most part, the warmth of the waters determine what lives in them. In warmer coastal waters, you are going to find coral reefs that provide homes to millions of species of fish and micro-organisms.</span>
4 0
3 years ago
Other questions:
  • if scientists are able to know that a specific bacterium is responsible for causing a deadly infection,why might it be important
    14·1 answer
  • What can insects do that no other arthropod can do
    12·1 answer
  • Cual es la rapidez registrada me ayudan porfa ​
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • what are two ways that the size of a population can increase ? what are two ways that the size of a population can decrease
    5·2 answers
  • What are offspring from a cross between two different plants called?
    12·2 answers
  • Compare and contrast the operation of negative and positive feedback mechanisms in maintaining homeostasis. Provide two examples
    7·1 answer
  • Which statement is true?
    12·2 answers
  • Which gives nourishment to embryo sac??<br>1) Tapetum<br>2) Endosperm<br>3) Thalamus<br>4)Nucellus​
    10·2 answers
  • Can virus show response against heat, chemical and temperature?If yes then how?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!