3 years ago

__________ are the raw data of experience, based on the activation of certain receptors located in the various sensory organs.

1 answer:

8 0

The answer is sensations. Sensation alludes to the way toward detecting our condition through touch, taste, sight, sound, and smell. This data is sent to our brains in crude frame where discernment becomes possibly the most important factor. Discernment is the way we decipher these sensations and hence comprehend everything around us.

You might be interested in

In the preparation of plasmid dna, what is the function of the sds?

olchik [2.2K]

The SDS detergent solubilizes the phospholipids and proteins

7 0

2 years ago

Desert plants are characterized by

Alecsey [184]

Desert plantsare characterized by :
- Long roots , that could reach deep within the ground for water sources
- Thin leaves that make them able to sustain more water against the hot weather

hope this helps

5 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

Which group of organic compunds store energy for long periods of time

scZoUnD [109]

Lipids!!!

Hope this helps! :)

8 0

3 years ago

Which three minerals are most likely used in the construction of a house?

Ahat [919]

Answer:

lead pencils (graphite)

fertilizer (potassium, sodium, calcium)

chalk (gypsum)

flashbulb (zirconium)

window glass/mirrors (silica)

table salt (halite)

Explanation:

3 0

3 years ago