The answer is Arachnids.
Crustaceans, Insects, and Arachnids belong to the phylum Arthropoda.
Of mentioned characteristics, most of the Insects have both wings and antennae. Remember all butterfly, bees, beetles, etc. Crustaceans (crabs, lobsters, shrimp, etc) have antennae, but they have no wings.
Thus, the only group of the mentioned that shows <span>neither wings nor antennae is Arachnids. Arachnids include scorpions, spiders, ticks, etc. and as it is known, these groups have neither </span><span>wings nor antennae.</span>
Answer : states of mmmatter... This is because elements at the right are majorly non metal and are liquid or gas at room temperature while those at the left are metal and mostly solid at room temperature
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
The 'D' in DNA stands for deoxyribose.
