1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetlanka [38]
3 years ago
7

I need help with dis, the lil box are the definition and I need to match the terms . CAN ANYONE HELP PLEASE ASAP

Biology
1 answer:
MrMuchimi3 years ago
5 0

Answer:

Precipitation - the fifth definition.

Condensation - the sixth definition.

Evaporation - the third definition.

Runoff - the first definition.

Infiltration - the second definition.

Discharge - the fourth definition.

<em>please correct me if im wrong</em>

You might be interested in
¿En qué consisten las evidencias Biogeográficas de la evolución?
kramer

Answer:

I dont understand

Explanation:

7 0
3 years ago
Read 2 more answers
Why is the property of water important to organisms in Aquatic and land habitats?
lana66690 [7]

Answer:

<u>Without a water supply, organisms in aquatic and land habitats will die. Organisms without access of water cannot access oxygen, and as a result of that, they would die. Oxygen is needed for organisms in order to survive. Water also helps insulate the living environment for these organisms.</u>

7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Help me out 50 pointsssssss
astra-53 [7]

Answer:

1 cilia 2 I don't know I'm so sorry

6 0
3 years ago
If These Organisms Were Arranged Into An Energy Pyramid, Which Organism Would Have The Least Amount Of Energy
liraira [26]

the answer is d:foxes i think

7 0
3 years ago
Read 2 more answers
Other questions:
  • A patient weighs 154 pounds. she must receive medication in the amount of 25 mg/kg/day. how many milligrams of medication should
    7·1 answer
  • What is the name of the vitamin d-deficiency disease in adults?​
    9·1 answer
  • What is meant by extinction
    12·2 answers
  • Although the process of translation is similar in bacteria and eukaryotes
    14·1 answer
  • Gravity on Earth is 9.8 m/s2,and gravity on the moon is 1.6 m/s2. So,if the mass of an object on earth is 40 kilo, it’s mass on
    15·2 answers
  • How is photosynthesis and cellular respiration cyclical ​
    8·1 answer
  • What is your first finger called?
    15·2 answers
  • When a plant is not strong enough to support its own weight what is most likely the problem
    15·1 answer
  • Plant processes of capillary action, transpiration, and root pressure are the result of seasonal changes, unique properties of w
    8·2 answers
  • In 3-5 sentences explain how increases in the human population impacts water resources. provide specific examples in your answer
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!