1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
3 years ago
8

What is a seabeam in science

Biology
2 answers:
dimaraw [331]3 years ago
7 0
It is a machine used to map the ocean floor might be located on a ship or might rely on a sonar to map the ocean floor features
nadya68 [22]3 years ago
6 0
Shipboard multi-transducer swath echo sounding system. 

Hope this helps.! :)


You might be interested in
Compare the processes of aerobic and anaerobic respiration. What are the reactants and products of each process? How much ATP do
Aleonysh [2.5K]

Answer:

Aerobic respiration saves a lot of energy compared to anaerobic respiration. Aerobic activities can generate up to 38 ATP per gram of glucose consumed. Anaerobic reactions only produce 2 ATP per gram of glucose.

8 0
3 years ago
Name 2 reasons that viruses are not considered living things
Sholpan [36]
Viruses are not considered living because they cannot survive without a host organism, and they do not exhibit the characteristics of life.
6 0
4 years ago
Read 2 more answers
The point beneath the surface where rock breaks and an earthquake is produced is known as the ______.
statuscvo [17]
<span>The point beneath the surface where rock breaks and an earthquake is produced is known as the focus.</span>
4 0
4 years ago
Read 2 more answers
Which statement is the best distinction between birds and other animals? help plz
yarga [219]

Answer:

Bird's have feathers

Explanation:

3 0
3 years ago
The segregation of alleles occurs during:
DIA [1.3K]
<span>The segregation of alleles occurs during meiosis I or option C "meiosis." M</span>eiosis is<span> a specialized type of cell division that reduces the chromosome number by half. Which is where it separates the twenty-four chromosomes twelve from your Father twelve from your Mother.

Hope this helps!
</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • ________ is when a sperm enters an egg. Fertilization Implantation Meiosis Mitosis
    13·2 answers
  • Courtney and kenzie are doing an experiment to determine which fish food gives their fish more energy. they have two fish tanks,
    13·2 answers
  • Which instrument has to played sitting down? *<br> Bassoon<br> Clarinet<br> Oboe<br> Saxophone
    14·1 answer
  • 3) This is a series of chemical reactions that take place in the chloroplasts and occur as part of the dark reactions
    6·1 answer
  • please help thermal energy transfer Click the links to open the resources below. These resources will help you complete the assi
    10·1 answer
  • Sound in poetry is connected to the meaning? True or false
    15·2 answers
  • 3. It is a genetic code that gives us all of our physical
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The unique properties of water enable life to exist on Earth. Which of these
    13·1 answer
  • When performing a Kirby-Bauer test how should the zone of inhibition be<br> measured?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!