1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
3 years ago
15

Describe the leaves of trees that live in the taiga

Geography
1 answer:
OleMash [197]3 years ago
6 0
Well first off it looks like a leaf that is green but problem a lot bigger and fatter and ya can problem eat um yummmmmmm
You might be interested in
Which of the following shows the correct location of Georgia?
Nata [24]
C, because it is bounded to the west by the Black Sea
5 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What words best describe the Baltic landscape? Select all that apply.
Leto [7]
Marshland
mountainous
tropical
8 0
3 years ago
Read 2 more answers
_______ magma causes powerful and explosive volcanic eruptions. A. Basaltic B. Andesitic C. Rhyolitic D. Composite
Pavlova-9 [17]
Rhyolitic <span>magma causes powerful and explosive volcanic eruptions. The correct option among all the options that are given in the question is the third option or option "C". Andesitic volcanoes also erupt explosively but the correct choice would be Rhyolitic. I hope that the answer has come to your help.</span>
3 0
3 years ago
It is possible to alter the weather on a small scale.
zaharov [31]

Answer:

yes

Explanation:

5 0
3 years ago
Other questions:
  • What affects the strength of gravity between two objects
    9·2 answers
  • The San Andreas fault is an example of which type of tectonic plate boundary? A. divergent B. convergent C. transform D. collisi
    14·1 answer
  • Guyss plzzzz heeellpppp
    14·1 answer
  • (4) What is the wavelength in meters and energy in joules of a photon in a radio wave from an AM station that has a 1530-kHz bro
    8·1 answer
  • In the 18th century what raised the living standards and spurred population growth?
    15·1 answer
  • Local topography and sea surface temperature contribute to differences in climate between various localities. State True or Fals
    11·2 answers
  • If a city is 10 square miles in area and has 9000 people, what is its<br> population density?
    9·1 answer
  • What causes contents to move
    13·2 answers
  • Find the total surface area of a cuboid with length 4 cm, breadth 3 cm and height 2 cm.
    14·1 answer
  • Appearance of a flat anvil top indicates that the developing thunderstorm cloud (cumulonimbus) has reached a(n) ______ portion o
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!