1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
3 years ago
12

What is the brown structure embedded in the cell membrane? What is the function of this brown structure?

Biology
1 answer:
MaRussiya [10]3 years ago
7 0
Those are protein channels they allow certain solutes in the membrane and inhibit solutes that are not needed and there’s many type of protein channels
You might be interested in
life cycles of sexually producing organisms involve the alternation of haploid and diploid stages true/false
kolbaska11 [484]

Answer:

True

Explanation:

<em>The life cycles of sexually producing organisms generally involve alternation between the haploid and diploid generations.</em>

<u>Sexual reproduction involves the fusion of gametes - fertilization. The gametes are haploid (n) and are usually formed by the reductional division (meiosis) of diploid (2n) sex cells. </u>

Haploid gametes represent the haploid stage of the life cycles of sexually reproducing organisms.  During fertilization, the male and female gametes fuse together to form a diploid zygote. The zygote then continues to divide equationally (mitosis) and differentiates to give rise to a baby and eventually to either male or female adult organism.

8 0
3 years ago
Could you please answer question one please
kondaur [170]
The answer is c. diffusion only
7 0
3 years ago
Compare and contrast meiosis 1 and meiosis 2.​
KATRIN_1 [288]
Is there suppose too be a photo attached because if so it’s not
3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Please help..<br> Thanks
VikaD [51]

Answer:

C. Burying dead/religious beliefs

4 0
3 years ago
Read 2 more answers
Other questions:
  • Bree and Eric are both in their 40s. They have spent their early adult years focusing on their education and careers. Now that t
    14·1 answer
  • A client performs two repetitions of a bench press exercise with 130 lb and gradually decreases the resistance with each set unt
    15·1 answer
  • Explain how a unicellular organism, such as a paramecium uses cilia to help with nutrition
    15·1 answer
  • Frogs go through metamorphosis.<br> a. True<br> b. False
    9·1 answer
  • A certain skin lotion is a fine mixture of water and various oils. This lotion is cloudy and cannot be separated into oil and wa
    15·1 answer
  • What occurs when too much of a population relys on something.
    8·2 answers
  • You learned in the previous section that archaea have ribosomes, similar to eukaryotes. How does this statement support the theo
    15·2 answers
  • Please help <br> View the picture
    14·1 answer
  • Which of the following are able to break a nitrogen triple bond?
    8·1 answer
  • What term describes members of the same species living at the same place ah the same time?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!