1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ankoles [38]
3 years ago
12

How do the nutrients that enter our cells compare with the food we eat

Biology
2 answers:
Lynna [10]3 years ago
5 0
<span>The food we eat is broken down into individual, microscopic nutrient molecules which enter the cell.

</span>
bekas [8.4K]3 years ago
3 0
The food we eat are very complex and insoluble. The nutrients that enters our cells are simple and soluble, this is because they have been through different digestion processes, include both physical and chemical digestions. For example, different enzymes are used to break down those complex food molecules into simpler forms, and they can then be absorbed into the blood to be assimilated with our body cells to perform their functions.
You might be interested in
10. In today's experiment, what are the water and oxygen? (enzymes, substrates, or products?)
marishachu [46]

Answer:

they are not permanently altered by the reaction they catalyze

3 0
3 years ago
Which organelle in a prokaryotic cell contains genetic information?
pav-90 [236]
Nucleoid contains genetic information.
5 0
2 years ago
Read 2 more answers
Why is it important to write down ones procedures first before conducting the experiment?
ser-zykov [4K]

1. So that during the experiment, you don't have to waste your time in figuring out what to do.

2. So that the instructions are clear and if there are any misconceptions, you can clear them out BEFORE the experiment.

3. To avoid trouble or risky scenarios.

4. It allows replication, where other scientist perform your experiment to ensure your findings are correct.

5. To avoid error, such as adding too much of salt into water.



3 0
4 years ago
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
How do immunizations help fight the polio epidemic?
In-s [12.5K]
I think the answer is D :) ........
3 0
4 years ago
Other questions:
  • The central controlling body within a living cell that is enclosed within the cell membrane is the _____.
    9·1 answer
  • How might a cell be affected by the development of a degradation-resistant cyclin mutant? *?
    8·1 answer
  • Despite considerable concern about the high rate of _________ use among pregnant women, studies have failed to find a homogeneou
    14·1 answer
  • 7. Which of the following is NOT a reason that cells divide?
    10·2 answers
  • A company makes a $5 profit on each non-faulty product it sells. Approximately 2% of the products manufactured are faulty, with
    14·2 answers
  • Which two organisms are most closely related, based on the tree above?
    15·1 answer
  • How do greenhouse effect allow for there to be life on earth? Explain
    8·1 answer
  • PLS HELPPPPP
    7·2 answers
  • 1. A student is completing a Punnett square for a trait (X/x) that is autosomal and inherited by the dominant allele. The father
    5·1 answer
  • Some organisms have genes that improve their ability to survive
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!