Answer:
they are not permanently altered by the reaction they catalyze
Nucleoid contains genetic information.
1. So that during the experiment, you don't have to waste your time in figuring out what to do.
2. So that the instructions are clear and if there are any misconceptions, you can clear them out BEFORE the experiment.
3. To avoid trouble or risky scenarios.
4. It allows replication, where other scientist perform your experiment to ensure your findings are correct.
5. To avoid error, such as adding too much of salt into water.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
I think the answer is D :) ........