1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
10

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.

Biology
1 answer:
dusya [7]3 years ago
8 0

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

You might be interested in
Gregor mendel crossbred pea plants for a variety of traits. What did he learn about dominant and recessive traits?
vladimir1956 [14]
Gregor Mendel crossbred two different pea plants. One of the plants had yellow peas (a dominant trait) and one of the plants had green peas (a recessive trait). The yellow pea plant was heterozygous for its trait meaning its alleles will be Yy. The green plant, because it is recessive, was homozygous for its trait, yy. When these plants were crossbred, two of the offspring resulted in heterozygous for the yellow trait and the other two offspring were homozygous for the green trait.
4 0
3 years ago
NEED HELP ASAP DUE NOW GIVING BRANLIST!!!!!!!!!!!!!!!!!!!!!!!
antoniya [11.8K]

Answer:

The 2nd and fifth anwser

3 0
3 years ago
Read 2 more answers
0.059 seconds equals how many milliseconds
adoni [48]
Id say it would be 59 milliseconds

6 0
3 years ago
Read 2 more answers
Oxygen is taken into the lungs during which process
Semmy [17]
The process by which oxygen is taken to the lungs is called Inhalation or Inspiration. 

4 0
4 years ago
Which organism in the food web below is found in the first trophies level of the ecosystem
pshichka [43]

I am going to assume you meant the "first trophic level" of the ecosystem. The first tropic level of an ecosystem is made up of producers, so the answer is C, Acorns.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the function of lymosomes
    11·2 answers
  • What causes thermal convection that drives plate motion?
    11·2 answers
  • Are the kidneys considered highly vascularized? why or why not?
    13·1 answer
  • There are 5 major types of asexual reproduction. Name all 5 and give an example of each.
    5·2 answers
  • If climate change is brought under control, which of the following would be most likely?
    14·1 answer
  • The essential nutrients Multiple Choice
    5·1 answer
  • Meselson and Stahl used density labeling of DNA to show that DNA replication occurs via a semiconservative mechanism. In their e
    14·1 answer
  • Guys please help. I promise I’ll mark brainlyest.
    11·1 answer
  • A seed company in Mississippi produces genetically modified cotton
    10·2 answers
  • 7. The order of nucleotides in a DNA molecule will impact the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!