5’ATGCCCGGGTGTCGTAGTTGA3’
Complete the complementary sequence for the template strand.
1 answer:
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
You might be interested in
Because the babies are born in an environment where they can prosper and have instincts to help them.
The answer would most likely be B
Hope this helps :)
My love for you will withstand a nuclear explosion
I can't give you the exact answer sense you haven't written down the statements
