1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelu [443]
4 years ago
14

The committee that advises the Fed on the growth of the money supply and the level of interest rates is the

Biology
1 answer:
il63 [147K]4 years ago
7 0
The committee that advised the Fed on the growth of the money supply and the level of interest rates is "B", the Federal Open Market Committee. 
<span>The Federal Open Market Committee is the branch of the Federal Reserve Board that determines USA monetary policy. It consists of twelve members and holds eight meetings a year. The committee reviews current economic and financial conditions to plot the way forward for the Federal monetary policy. It also assesses the risks to its long-term goals of price stability and sustainable economic growth.</span>
You might be interested in
Gabbro and _____ have similar chemical characteristics.
torisob [31]
The answer is a. basalt. Gabbro rocks are more related to basalt in terms of chemical characteristics. They are both igneous rocks but basalt is an extrusive rock that cools quickly while gabbro is intrusive and cools slowly. So, basalt rocks are fine-grained while gabbro are coars-grained.
5 0
3 years ago
Why will many species of bird migrate to warmer climate during the winter
Doss [256]
Bird migrations began with the recession of the glaciers during the ice age. You will notice a great increase in insects in the spring time and early summer.The birds moved North to take advantage of this increase in the food supply that followed the warming in the spring and early summer. Their reproductive organs temporarily developed so they could lay eggs and raise a family. Look at the early flush of Night crawlers in the moist times of the early rains. By mid summer most of the insects have matured, mated and died. Their eggs have hatched and turned to larva and moved underground until next spring. The shortening of the days causes the reproductive functions to decrease and signals the birds that the food will soon become scarce. They move back to the area that makes it the easiest to find food and avoid freezing. which of course is the warmer climates nearer the equator. Not all birds move past the Tropics at approximately 30 degrees. Some like Chickadees may move down from Mi or Mn or Canada only as far south as Indiana. Some migrations may be quite short. For example from the mountains down to the plains. They don't generally reproduce in the warmer winter climes they migrate to. In the spring time they migrate along paths of the retreating glaciers. As the climate warms away from the tropics the birds follow the emerging insects etc to the birds selected breeding grounds.with increased insects and longer days to feed the hatching's. It is necesary to understand why they move to cooler climates in the summer to under stand why they move to eh warmer ones in the fall. As the days shorten the food supply dwindles and the babies have fledged. They move to warmer climates in winter to rest and refuel for the next years migration.
8 0
3 years ago
What type of biodiversity restoration are biologists practicing when they plant nitrogen-fixing plant species in an area where t
RSB [31]

Answer:

The type of biodiversity been practiced is REFORESTATION .

Explanation:

Reforestation is the deliberate or natural process by which destroyed plants are re-planted in a particular forest. Deforestation usually brings about destruction of different plants species and this normally throws the ecosystem out of balance. The negative process can be reversed by mean of reforestation, in which new plants are planted in the place of the destroyed ones.

3 0
3 years ago
Read 2 more answers
True or false in size exclusion chromatography, the smallest proteins are eluted last.
Vikki [24]
Trueeeeeeeeeeeeeeeee
7 0
3 years ago
Artificial selection involves the use of robots and test tubes babies
photoshop1234 [79]
This is true hope this helps
5 0
3 years ago
Other questions:
  • A unique species of snail has been discovered in the Negev Desert. At night, these snails use a toothlike rasping organ in their
    10·1 answer
  • Describe a subculture that you are familiar with. What are the characteristics that identify it as a subculture?
    11·2 answers
  • What is the most important body system for maintaining homeostasis?
    5·2 answers
  • When you’re in a cold place in December and you’re planning a vacation for February, are you interested in a location’s weather
    6·1 answer
  • A wolf's diploid number of chromosomes is 78. How would the number of chromosomes in the wolf's body cells compare to the number
    10·1 answer
  • When a population has a gene with two alleles circulating, how many possible genotypes are there?
    12·1 answer
  • The _____ temperature and the _____ pressure on Earth's inner core force it to remain a solid. (4 points)
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • QUICK!! The diagram below shows the molecular structure of glucose. Glucose is a
    10·1 answer
  • Anyone know how to do this?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!