All categories

2 years ago

What effect can a buildup of pesticides have over the long term environment

1 answer:

5 0

A buildup of pesticides could get into an animal. That animal will be killed by a hunter. The hunter eats the animal with the pesticide. The hunter then becomes sick. This is just an example but you can see what i'm getting at.

You might be interested in

This is an active transport mechanism by which cells pump sodium and potassium ions against the concentration gradient.

faltersainse [42]

Answer:

Primary active transport

Explanation:

Primary active transport is the transport in which molecules are moved against their gradient, with direct use of ATP as an energy source. Na/K pump is an example of primary active transport: Na ions are transported out of cell, K ions are moved into the cell. This pumps maintain concentrations of those ions and also creates voltage across the cell membrane, which can be used for the secondary active transport of other molecules (e.g. glucose).

4 0

2 years ago

Read 2 more answers

What traits might be ideal to create children who are champion skiers? If it were possible for parents to select these genes, is

k0ka [10]

Answer:

well athlete parents maybe or parents that used to ski, im not sure since learning how to ski and getting good at is isnt really part of genetics

Explanation:

7 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

Genotype<br><br> A: The physical characteristics <br> B: The set of alleles

leonid [27]

Answer:

The answer is B. the set of alleles.

Explanation:

5 0

2 years ago

Read 2 more answers

Why are vestigial structures are considered examples of<br>homologous structures?

Vera_Pavlovna [14]

Vestigial structures are often homologous to structures that are functioning normally in other species. Therefore, vestigial structures can be considered the evidence for evolution, the process by which beneficial heritable traits arise in populations over an extended period of time.

5 0

2 years ago