1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
13

A population of snakes that eat small rodents enters a new habitat. In the new habitat, there are many species of rodents, and t

heir populations are high because there are few natural predators. What will most likely be the effect on the genetic variation of the snake population?
anyone know the answer?
Biology
2 answers:
Nata [24]3 years ago
5 0
<span>Genetic variation will increase because of a new habitat and food source.</span>
babunello [35]3 years ago
3 0

Answer:

The snake population would increase the genetic variations to fill the available empty ecological niches in the new habitat.

Explanation:

According to the given information, the new habitat of the snake population has a variety of prey species and a few predators. This would make the snake population adapt themselves to feed on the various prey species to avoid any competition.

Progeny of snake population would adapt themselves in different directions to feed on various species of available rodents. The availability of empty ecological niches (various rodent species here) leads to adaptive radiation in the parent population. The progeny of the parent population exhibits divergent evolution and become adapted to feed on different rodent species.

You might be interested in
Place the human into each of the seven hierarchical taxonomic categories, beginning with Kingdom and ending with the scientific
kolezko [41]
Chordata
Mammalia
Primates
Homidae
Homo
Sapiens

5 0
2 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Which situation does not illustrate kinetic energy?
DIA [1.3K]
Kinetic energy is the energy of motion, even if it is slow so the answer is A.) because the baseball is not moving
8 0
3 years ago
Read 2 more answers
Why is mitosis important to your body
Hitman42 [59]

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ Mitosis is important for our body because mitosis makes our bodies grow and develop. Without mitosis, we wouldn't grow and our cells wouldn't be repaired or replaced.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

8 0
3 years ago
Read 2 more answers
HURRY BEST ANSWER GET BRAINLEIST
Jet001 [13]
The answer is B. both need food and air 
8 0
3 years ago
Other questions:
  • BEST ANSWER GETS BRAINLIES!!!!!
    10·2 answers
  • Mr. Torres interacts positively with his students. Which statement describes the BEST evidence to support this?
    9·2 answers
  • If your job requires you to use a respirator, your employer is required to do three things. What is missing from the list?
    13·1 answer
  • In the above food web, energy is transferred from wheat to the mouse and from the mouse to the coyote when these organisms are c
    8·2 answers
  • Please what are the major branches of biology​
    6·1 answer
  • The actual pair of alleles present in the cells of an individual is known as the:
    7·1 answer
  • HELPPP I GIVE BRAINLIEST!!!
    15·1 answer
  • What is dispersal of seeds <br>​
    7·1 answer
  • Identify the small facial bones found in the medial wall of the orbit.
    12·1 answer
  • A tea bag can model a cell. The fabric of the bag
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!