1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OverLord2011 [107]
3 years ago
7

In which mitotic phase do the chromosomes condense and does the mitotic spindle begin to form? See section 12.2 (page 258) ?

Biology
1 answer:
sasho [114]3 years ago
6 0
If this is where they are condensing, it is prophase (the 1st phase)
You might be interested in
Why are antibiotics unhelpful for treating the common cold?
andrey2020 [161]
D:viruses are not killed by antibiotics.
3 0
3 years ago
Read 2 more answers
Which function do stems and roots share
jeka57 [31]
Well they share the function of giving nutrition to the buds and the leaves on the plant , but they preform this function in different way from each other
3 0
3 years ago
Read 2 more answers
When fertilizer runs off into streams and lakes, what increases in the water? Select all that apply.
Goshia [24]
D the amount of Toxic Chemicals
7 0
3 years ago
True or false: Due to starvation, amino acids from muscle tissue are converted into glucose. This wastes muscle tissue and can l
Zanzabum

Answer:

True

Explanation:

Because all the amino acids in the tissue muscle are converted tp glucose so u could have energy to live

3 0
2 years ago
What does the diencephalon do in the nervous system?
horsena [70]

<span>The diencephalon transmits sensory data among the </span><span>brain sections and manages several autonomic functions of the </span>peripheral nervous system<span>.  It also links the anatomy of the </span>endocrine system with the nervous system and function in coexistence with the limbic system structures to produce and control memories and feelings.

6 0
3 years ago
Other questions:
  • Jamie pushed and pushed on the refrigerator but it would not budge! Jamie wondered what he could do to help move the heavy refri
    8·2 answers
  • Which personal protective equipment (ppe) should the nurse don to enter the room of a client who is diagnosed with clostridium d
    9·1 answer
  • If people planted huge numbers of trees and other plants how might the carbon dioxide levels change?
    11·1 answer
  • Rutherford coined the term used for the simplest positive charged particle and called it the
    15·2 answers
  • Question 6 of 20
    15·2 answers
  • What are the three things that blood is responsible for transporting through the body.
    5·1 answer
  • QUICK BRAINLEST PLEASE! I is a easy question... I just don't know it.
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is el niño and how does it affect the climate​
    12·1 answer
  • The process of natural selection relies on variation within a population or species and occurs when -
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!