1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
8

Which term best describes an animal that, although generating a significant amount of heat through metabolism, nonetheless does

not maintain a constant body temperature
Biology
1 answer:
Goryan [66]3 years ago
3 0
<h2>Heterothermic endotherm</h2>

Explanation:

  • Heterothermic endotherms are those organisms whose internal heat level shifts, however the vast majority of its warmth is delivered by its own tissues.  
  • <u> Endothermy: </u>Endothermy is the system where through intern production body acquires heat. The heat is generated through metabolic system, possessed by Endotherm organisms. To produce heat is vigorously expensive, which implies that these organisms have high lively and wholesome necessities.  
  • <u> Heterothermy:</u> Heterothermy happens in organisms which can change from endothermy to ectothermy. This normally occurs in little winged organisms and warm blooded organisms with high metabolic rates (very dynamic and with high lively prerequisites), which decline their internal heat level during idleness periods. These latency periods for the most part are yearly or day by day.
You might be interested in
Can anyone explain it? The one I chose is what I think is correct...
Kitty [74]

Although I don't know for sure what is an epicycle, I think your answer is right and I would try to explain as apliable to solar systems on the Milky Way known through astronomical discoveries, conside ring just one star called "Sun" and a few distant planets describing a certain type of movement around it. I should add that the Moon describes the same type of movement around the Earth ( which is not a star), being the only natural satelite of the planet Earth, being kept around it by the circumstances created by the proportion of forces occured while moving

5 0
3 years ago
The mother has long fur:
solniwko [45]

Answer:

are you looking for a pedigree, or a square pedigree?

Explanation:

7 0
3 years ago
A field of sunflowers facing the sun is an example of
Crank

Answer:

Phototropism

Explanation:

Phototropism. Although both types of movement orient plants toward a light source, heliotropism is not the same as phototropism. Phototropism is the term that describes the growth of a plant toward any light source.

6 0
3 years ago
Read 2 more answers
Species richness generally increases toward the poles, true or false
IgorC [24]

Answer: It is True species richness grows twoards the poles  

8 0
4 years ago
List four functions of protein
deff fn [24]

enzyme activity, cell to cell recognition, cell signalling, transporting materials

3 0
4 years ago
Read 2 more answers
Other questions:
  • The idea that all cells arise from the division of preexisting cells was first stated by a. Anton van Leeuwenhoek. c. Robert Hoo
    12·1 answer
  • Which term describes "one or more cells that carry out all of the processes needed to sustain life"?
    12·2 answers
  • Which of these things that animals need travel through a food chain? A- herbivores B- ecosystem C- air and sunshine D- nutrients
    12·1 answer
  • Why was the purple loosestrife able spread so rabidly?
    6·1 answer
  • What do all vertebrates have in common?
    10·2 answers
  • 5. What are some safety precautions that you<br> should follow when working in the laboratory
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • When do you use your sense of touch?
    13·1 answer
  • Which characterisitics of the DNA helps it function as a set of instructions for making these specific proteins?
    13·1 answer
  • James told everyone a scary story on his camping trip? underline the adjectives in each sentence...
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!