1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
2 years ago
6

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39

). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
Biology
1 answer:
umka2103 [35]2 years ago
6 0

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
You might be interested in
What are the possible genotypes of the parent of an offspring who has wavy (Wh) hair
AleksandrR [38]
Wouldn't it be genetics? Or traits?
8 0
3 years ago
6. Cell membranes are primarily composed of a double layer of phospholipids. Why are phospholipids particularly
Andrews [41]

Answer:

B i hope this help

Explanation:

The cell membrane consists primarily of a thin layer of phospholipids which spontaneously arrange so that the hydrophobic "tail" regions are shielded from the surrounding polar fluid, causing the more hydrophilic "head" regions to associate with the cytosolic and extracellular faces of the resulting bilayer. This forms a continuous, spherical lipid bilayer approximately 7 nm thick, barely discernible with a transmission electron microscope.

The arrangement of hydrophilic and hydrophobic heads of the lipid bilayer prevent polar solutes (e.g. amino acids, nucleic acids, carbohydrates, proteins, and ions) from diffusing across the membrane, but generally allows for the passive diffusion of hydrophobic molecules. This affords the cell the ability to control the movement of these substances via transmembrane protein complexes such as pores and gates.

8 0
3 years ago
PLEASS HELP.........................
zheka24 [161]

Answer:

Active Transport, A, Osmosis

Explanation:

4 0
2 years ago
Ms. Jones is teaching her class about rocks and minerals. She holds up a rainbow chocolate chip cookie and explains that the coo
Alenkasestr [34]

Answer:

The answer would be C) Minerals. I hope this helps!

3 0
2 years ago
Read 2 more answers
18 POINTS
Maurinko [17]

Answer:

a animal that eats plants is a herbivore

8 0
2 years ago
Read 2 more answers
Other questions:
  • 36. Mammals are exposed to a variety of outside temperatures. However, they are able to
    12·1 answer
  • It is important that the loop control ____ be altered within the body of the loop.
    12·1 answer
  • A male cardinal’s red color is an example of a trait affected by natural selection. The females of the species choose mates base
    7·1 answer
  • Transport of molecules within animal cells is assisted by a system of internal membranes
    12·1 answer
  • I need help please could someone
    5·1 answer
  • Fill in the missing atoms or groups in the skeletal structure below so that it is a monounsaturated fatty acid with 10 carbons t
    9·1 answer
  • Nutrients from digested food move front the digestive system directly to the -
    6·1 answer
  • What is one of the ways by which nutrient pollution does not affect humans in the Chesapeake Bay area
    15·1 answer
  • The stage in the cell cycle during which the cell performs its normal function
    15·1 answer
  • 3) An astronomer observes four stars from two different locations on Earth. For which star will the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!