1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
6

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39

). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
Biology
1 answer:
umka2103 [35]3 years ago
6 0

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
You might be interested in
Caffeine is an inhibitor of phosphodiesterase. Therefore, the cells of a person who has recently consumed coffee would have incr
adell [148]

Answer:

B) cAMP

Explanation:

Phosphodiesterase is an enzyme that breaks a phosphodiester bond, for example in molecules such as cAMP and cGMP. So, phosphodiestarases are  are regulators of signal transduction: regulate the duration of signaling pathway.

Caffeine is  central-nervous-system stimulant and the mechanisms of its action usually are: mobilization of intracellular calcium or inhibition of specific phosphodiesterases.

7 0
3 years ago
Cell theory states:
kkurt [141]
For the 1st one I would say C as it says Cells are the smallest form of life, for the 2nd one I would say C because the others all have animal which doesn't have cell wall, 3rd is A
4 0
3 years ago
Read 2 more answers
Hashimoto's disease is an autoimmune disordee that decreases the ability of the thyroid gland to produce T3 and T4. The student
MAVERICK [17]

TSH level, because if we are testing the levels of TSH with a person who has Hashimoto's disease and one who does not have Hashimoto's disease.

8 0
3 years ago
Which of the following substances dissolve to a significant extent in water?
Valentin [98]
Polar substances .
u havent given any option
5 0
3 years ago
A type of glycocalyx called the _______ is loosely attached to the bacterial cell and protects it from dehydration and loss of n
IrinaVladis [17]

A type of glycocalyx called the slime layer is loosely attached to the bacterial cell and protects it from dehydration and loss of nutrients .

<h3>What is glycocalyx ?</h3>

The glycocalyx is a thick outer covering of the plasma membrane .it is of stands of sugars and proteins bound together ,the result is a thick ,sticky layer that helps cells stay put in environments with lots of physical stress .it is a glycoprotein and glycolipid covering that surrounds the cell membranes of bacteria ,epithelial cells and other cells .

Glycocalyx in humans : it is important to both vascular function and the digestive system . your blood vessels actually tiny tubes made of cells .the cells on the very inside of the tube are called endothelial cells and have to withstand the stress of blood flowing over them constantly. endothelial cells produce a glycocalyx which helps leukocytes and thrombocytes stick to blood vessel walls.it is the protective layer of the endothelial cells found in the lumen side of the vessels .

Glycocalyx in bacteria : most of the bacteria produce glycocalyx but some are expert .these expert bacteria make a very thick glycocalyx that helps them to adhere to each other and surfaces in extreme environments .bacteria use the glycocalyx to make thick films of bacteria in nature as well ,called a biofilm .

Learn more about glycocalyx here:

brainly.com/question/5590059

#SPJ4

3 0
2 years ago
Other questions:
  • The three major types of rocks are igneous, sedimentary, and _____.
    14·2 answers
  • NEED HELP ASAP!!
    12·2 answers
  • Question 3.3. Which statement best explains how the structure of a starch molecule relates to the function of the molecule?
    6·1 answer
  • What kinds of surface features are found on mercury? (select all that apply.)?
    15·1 answer
  • What test can be used to determine whether a patient has an infectious or autoimmune disease?
    7·2 answers
  • How did the lab activities help you answer the lesson
    13·1 answer
  • Which of the following statements can correctly create a DataOutputStream to write to a file named out.dat? Select all that appl
    15·1 answer
  • Please help!!! Will mark the brainliest!!!!!
    5·1 answer
  • Select the correct answer from the drop-down menu.
    9·1 answer
  • A mutation occurs in the sex cell of a full-grown Zebra. the mutation affects the genes responsible. for producing blood protein
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!