1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
6

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39

). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
Biology
1 answer:
umka2103 [35]3 years ago
6 0

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
You might be interested in
HURRY PLEASE I NEED A PARAGRAPH. Describe how cell membranes are selectively permeable.
Simora [160]

Explanation:

Cell membranes are selectively permeable. Some solutes cross the membrane freely, some cross with assistance, and others do not cross at all. A few lipophilic substances move freely across the cell membrane by passive diffusion. ... Large molecules do not cross intact cell membranes, except in certain special cases.

4 0
3 years ago
Which statement is most true concerning carbon in sediments and rocks? ncdc.noaa.gov They receive the same amount from the ocean
VikaD [51]

the correct answer would be they receive the same amount from the ocean as they release to the atmosphere

hoped this helped have a great day :)

8 0
3 years ago
Angiotensin II is a potent ____________ that helps regulate blood pressure. Angiotensinogen, is an inactive hormone synthesized
Hatshy [7]

Answer:

Angiotensin II is a potein VASOCONSTRICTOR that helps regulate blood pressure. Angiotensinogen, is an inactive hormone synthesized and released continuously from the LIVER. Its activation, which occurs within the BLOOD, is initiated by the enzyme renin. Renin is released from the juxtaglomerular apparatus of the KIDNEYS in response to either (1) LOW blood pressure (as detected by decreased stretch of BARORECEPTORS within granular cells, or by decreased NaCl detected by CHEMORECEPTORS within macula densa cells); or (2) stimulation by the SYMPATHETIC  division. The sequential action of renin and angiotensin converting enzyme (ACE) causes the formation of angiotensin II (the active form of the hormone).

Explanation:

Angiotensin is a peptide hormones that regulate blood pressure by causing increase in blood pressure through vasoconstriction. It is a part of the renin- angiotensin system that regulate the internal pressure of the blood. It is stimulated when the level of blood pressure reduces or there is an decrease in the sodium chloride in the blood. It effects is to vasoconstrict the blood vessels thereby increasing the blood pressure in the vessels. Angiotensinogen is the inactive hormone synthesized by the liver and upon activation through baroreceptors or chemoreceptors, the liver releases angiotensinogen into the blood stream to be ctivated by the enzyme secreted from the kidney's juxtaglumerular apparatusand then activated to teh angiotensinogen I, angiotensinoI is then activated into angiotensin II by the angiotensin II by the angiotensin converting enzyme. Angiotensin also causes the increase in the aldosterone secretion from the adrenal cortex to promote the retention of sodium by the kidneys, this also helps to increaee the blood pressure. Various receptors helps in signalling the body to a reduced blood pressure level. This includes the baroreceptors which are pressure receptors and detect changes in pressure of the blood; chemorecptors which are chemical receptors that detect the change in the concentration of sodium and chloride ion in the blood. All this function together with the sympathetic division of the CNS to help the body regulates its change in blood pressure in a given time.

3 0
3 years ago
9) Choose the best answer.
MrRa [10]

Answer:

I'm not sure about 9 and 10

11) True

12) False

5 0
3 years ago
!! What is labeled "A" on the chart?
Leto [7]

Answer:

can you put the chart

Explanation:

not enough information

6 0
2 years ago
Other questions:
  • Which partly explains why the domestication of animals tended to increase the human food supply?
    12·1 answer
  • With the chemical indicator Sudan III, If the test is negative then which type of macro-molecule is NOT present
    15·1 answer
  • trees that are installed individually or in small numbers to provide an eye- catching contrast to the more numerous background t
    15·1 answer
  • From which layer of atmosphere is the top layer of the thermosphere? A.troposphere B. Stratosphere C.mesosphere D.exosphere
    13·1 answer
  • Describe two ways in which fungi differ from other heterotrophic organisms in how they obtain the digest their food.
    5·1 answer
  • Identify the different types of hydrocarbons
    9·1 answer
  • According to the rivet model of community structure, A) species share a community because of similar abiotic requirements. B) co
    15·1 answer
  • Hiiiiii!!! It's me again, and I need help with biology again because I didn't read the dang lesson. So please helppppp!!!
    5·1 answer
  • Jack has a condition where mucus builds up in his lungs. This makes it more difficult for gas exchange to take place. Which two
    11·1 answer
  • Regulation of heart rate, blood pressure, and digestive functions are carried out by the ______________________.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!