Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Double and triple covalent bonds are stronger than single covalent bonds and they are characterized by the sharing of four or six electrons between atoms, respectively.
Renewable energy is growing fast in the U.S., but fossil fuels still dominate. Most Americans (77%) say it's more important for the United States to develop alternative energy sources, such as solar and wind power, than to produce more coal, oil and other fossil fuels, according to a recent Pew Research Center survey
<span>I am going to answer this as a golf player myself The answer to this question is it is rather a chain of event where where weight shift occurs gradually while back swing but the weight is originally on the back foot and for good back swing the weight should be on it so that more power can be delivered while swinging
So the correct answer is back foot</span>
