Question

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?

Answer 1

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

The complementary strand is :

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

The base sequence of the complimentary strand is:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.

1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.