1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
6

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39

). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?
Biology
1 answer:
umka2103 [35]3 years ago
6 0

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
You might be interested in
If i show a dominant trait do one of my parents have to show the same trait? explain?​
Mama L [17]
Well, not exactly like some parents have blue eyes and they have a dominant brown eyed child. This can happen because of the gynotype. The history of the child’s parents probably have some brown eyes which caused the child to have brown eyes. But usually the parent does express a dominant trait like the child.
7 0
3 years ago
Select the correct answer. In nature, which pigment gives red algae its color? A. Phycoerythrin B. Fucoxanthin C. Chlorophyll D.
Volgvan

Answer:

The Answer is A

Explanation:

phycoerythrin is the pigment that gives red algae its color.

5 0
2 years ago
A mutation in the operator region of the trp operon can prevent the trp repressor from binding to this operator. When these muta
Brilliant_brown [7]

Answer:

d. Tryptophan would bind to the repressor

Explanation:

However,the repressor would not be able to bind to the operator and switch off transcription.The cell would still be making tryptophan even though it is being supplied by the medium in which it is growing.This is a waste of energy.

4 0
3 years ago
. The graph below represents the relationship between the amount of spring rainfall recorded at a pond and the number of frogs i
Taya2010 [7]

Answer:

Use the drawing tools to form the correct answer on the graph.

Graph the line that represents this equation:

Explanation:

6 0
3 years ago
How do aerobic and anaerobic reactions differ
valina [46]

They both produce energy but the process is different. Aerobic respiration is when the cell produces energy using oxygen while anaerobic uses electron acceptors. Aerobic respiration also makes more energy.

4 0
3 years ago
Read 2 more answers
Other questions:
  • WILL GIVE BRAINIEST!! PLEASE HELP ASAP!!
    5·1 answer
  • Which of these is a basic need of all organisms?
    13·2 answers
  • Which of the following correctly matches a phase of the cell cycle with its description?
    5·1 answer
  • A farmer is being troubled by coyotes eating his sheep. in an attempt to solve the problem, he kills a sheep and laces its body
    5·1 answer
  • Sedimentary rocks form when sand, mud, and pebbles create layers on top of each other. The pressure builds as each layer is adde
    6·1 answer
  • Do you think you can see the entire nerve cell explain
    8·2 answers
  • What is the ideal time of day to perform resistance training and ingest protein to increase muscle hypertrophy?
    14·2 answers
  • Match each number to correct letter.
    15·1 answer
  • Explain what factors can lead to genetic<br> variation within a population.
    10·1 answer
  • In African savannas elephants are a keystone species. Elephants eat small trees, such as acacia, that grow on the savanna. Even
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!