1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
5

David has sustained an injury to his neck that has resulted in the complete loss of sensation to the posterior side of his upper

arm and an inability to extend his index finger. which nerve has most likely been damaged as a result of his injury?
Biology
1 answer:
slavikrds [6]3 years ago
4 0

Answer;

Radial nerve

Explanation

-The nerve that is most likely to be damaged as a result of his injury is the radial nerve.

-The radial nerve is a nerve in the human body that supplies the posterior portion of the upper limb.

-It innervates the medial and lateral heads of the triceps brachii muscle of the arm, as well as all 12 muscles in the posterior osteofascial compartment of the forearm and the associated joints and overlying skin.

You might be interested in
How can a decrease in blood pressure affect blood flow?
postnew [5]

A decrease in blood pressure could slow down the blood going to your heart causing nausea, blurred vision, and even fainting.

7 0
3 years ago
What safeguards must society adopt to handle the rapid advances in biotechnology?
valentina_108 [34]
The answer to this is bioethics.

Bioethics is the ethics of medical and biological research

Hope this helped :)
Have a great day
7 0
3 years ago
The outward manifestation of a disease, often influenced by both genes and the environment, is called the disease:
xeze [42]

Answer: C. phenotype.

Explanation:

The disease phenotype is an observable characteristic or trait of a disease. It is influenced by the genetic make up and the surrounding environment of the organism. The appearance of symptoms, biochemical and physiological development of the disease is associated with the traits inherited from parents and also under the influence of the environment.

4 0
2 years ago
In eukaryotes, extranuclear inheritance occurs when genetic information is transmitted by mechanisms other than through nuclear
Vlad [161]

Answer:

- cpDNA organization is more similar to that of prokaryotes than eukaryotes

- chloroplast chromosomes contain genes that are involved in photophosphorylation

6 0
3 years ago
The hormone insulin is secreted by the pancreas. Which activity is MOST likely to
Oksana_A [137]

Answer:

Eating

<em><u>Hope this helps! <3</u></em>

6 0
2 years ago
Other questions:
  • How does a catalyst influence a chemical reaction?
    7·2 answers
  • A place from which heat energy comes?
    5·2 answers
  • Any help will do, thanks!
    15·2 answers
  • Need help <br> Compare cells and label
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which is one way that the movement of matter through an ecosystem is different from the transfer of energy?
    9·1 answer
  • The surface area of a sphere can be approximated as follows:
    5·1 answer
  • In certain diseases, osteoclast activity takes over osteoblast activity, which will cause the bone to In certain diseases, osteo
    10·1 answer
  • Which of the following are the functions of the skeletal system?
    6·2 answers
  • How different enzymes can be used to demonstrate which macromolecule the transforming factor of bacteria is?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!