<h2>Energy </h2>
Explanation:
Energy flows in only one direction through an ecosystem
- The Sun supports most of Earth's ecosystems
- Plants create chemical energy from abiotic factors that include solar energy and chemosynthesizing bacteria create usable chemical energy from unusable chemical energy
- The food energy created by producers is passed to consumers, scavengers, and decomposers
- Energy flows through an ecosystem in only one direction, it is passed from organisms at one trophic level or energy level to organisms in the next trophic level
- Most of the energy at a trophic level – about 90% – is used at that trophic level and organisms need it for growth, locomotion, heating themselves, and reproduction
- So animals at the second trophic level have only about 10% as much energy available to them as do organisms at the first trophic level
- Animals at the third level have only 10% as much available to them as those at the second level
Answer:
The correct option is b (complementary).
Answer:
Thus, the major difference between DNA and RNA is that DNA is double-stranded and RNA is single-stranded. DNA is responsible for genetic information transmission, whereas RNA transmits genetic codes that are necessary for protein creation.
<h2>
good morning friend </h2>
Starfish have a unique form of digestion in the animal kingdom and a water-vascular system that allows the animal to breathe.
All your answers should be in this article:
http://animals.mom.me/feeding-respiration-starfish-6596.html
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
