1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
8

Cellular respiration allows organisms to release the energy stored in the chemical bonds of glucose, C6H12O6. The energy in gluc

ose is used to produce ATP, which cells use to supply their energy needs. During aerobic cellular respiration, oxygen is reduced and _________ is produced as a by-product of this specific intermediate reaction.
Biology
2 answers:
Paha777 [63]3 years ago
7 0

The right answer is water.

The transformation of oxygen into water is done at the level of the mitochondria in a process called oxidative phosphorylation.

In eukaryotes, oxidative phosphorylation occurs in the inner mitochondrial membrane, specifically at the cristae of this membrane. It includes the respiratory chain, which provides oxidation of coenzymes reduced by the Krebs cycle, and ATP synthase, an enzyme capable of phosphorylating ADP to ATP from the energy released by the respiratory chain during the course of treatment. oxidation of coenzymes. This energy is stored as an electrochemical gradient across the inner membrane of the mitochondria by proton pumps that generate a proton concentration gradient during the flow of electrons along the respiratory chain. The final step of the latter is the reduction of one oxygen molecule by four electrons to form two molecules of water by fixing four protons.

Scrat [10]3 years ago
5 0

The correct answer for this question is water.

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What do you think these moth wings mimic? Why do you think this kind of mimicry can protect the moth?
Drupady [299]

Explanation: I think camouflage method or a design that scares away predators.

8 0
3 years ago
Resource partitioning results in: a move from the realized niche to the fundamental niche for both species. individuals of each
bazaltina [42]

Answer:

a move from the fundamental niche to the realized niche for both species.

Explanation:

The niche of an organism is the functional role of the organism in the community or the ecosystem as a whole. This include the environment an organism lives and all the jobs it does in it.

Fundamental niche refers to all the possible functional roles of an organism in an ecosystem while realized niche refers to the specific roles the organism is limited to as a result of resource limitation, competition or other factors.

Resource partitioning involves the division of limited resources among organisms so as to avoid competition within the niche.

<em>Hence, resource partitioning causes a move from the fundamental niche of an organism to the realized  niche of that organism. </em>

7 0
3 years ago
Use the words air and mass to describe cold and warm fronts
SVETLANKA909090 [29]
<span>A warm front is the boundary between a warm air mass and a cold air mass it is overtaking. So a cold front would be the opposite. 

</span>
7 0
2 years ago
Read 2 more answers
Substances transported by facilitated diffusion
Alinara [238K]

Answer:

I think it is B

Explanation:

hope it is right!

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these is an example of potential energy?
    11·2 answers
  • CAN SOMEONE PLZ HELP ME!! ;_;
    10·2 answers
  • The term meaning situated nearest the midline or beginning of a body structure is __________.
    14·1 answer
  • Which of the following describes a community.
    8·1 answer
  • The steroid lipid cholesterol is a component of membranes. identify true statements about cholesterol and its role in membrane f
    7·1 answer
  • What does the ocean do to the CO2 in the atmosphere?
    6·2 answers
  • Please can anyone help me out in this whole definition actually I can't understand it ​
    10·1 answer
  • Informational Writing-Write a strong Table of Contents
    8·1 answer
  • 3. Look at the rock cycle.
    12·1 answer
  • Where are proteins, such as enzymes, that are to be secreted from the cells produced?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!