The answer is A
The abstinence violation effect
<span>This effect
occurs when an individual, having made a personal commitment to abstain
from using a substance or to stop engaging in some other unwanted behavior, has
an initial lapse whereby the substance or behavior is engaged in at least once.
Some individuals may then proceed to uncontrolled use. It occurs when the
person attributes the cause of the initial lapse to internal, stable, and
global factors within.</span>
Answer: Option A
Explanation:
Birds attach the bur of the plant which helps in the pollination. The birds sit on the plant and the burs of the plant gets attached in the legs of the birds which is transferred from one place to another.
Seeds at a different place will help in reproduction and growth of the plants. In this case the birds are carrier of the burs.
This is how the birds help in the reproduction of the plants by becoming the messenger.
A.rotation of earth is the correct answear
Answer:
Fimbriae
Explanation:
Fimbriae are hair-like structures made up of proteins, that surround the outer surface of a bacterium. It helps them stick to the surfaces, tissues, and even other cells. The term fimbriae is often interchanged with pilli but pilli are longer. They are found in both gram negative and gram positive bacteria.
Attached is a picture of a bacterium.
Answer:
Explanation:
a. The template strand is:
ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT
The coding strand is
TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA
The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'
b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'
c. N terminus Met-Val-Arg-Ser-Asp C terminus
d. GGAGGA
e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.
