1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Studentka2010 [4]
4 years ago
11

What is the overall equation for photosynthesis?

Biology
2 answers:
seraphim [82]4 years ago
8 0
6CO2 + 6H2O + light energy = C6H12O6 + 6O2
shusha [124]4 years ago
3 0
H20+Sunlight+CO2=C6H12O6
^                          ^         ^
Water   Carbon Dioxide  Glucose 
You might be interested in
A fire is burning halfway up the slope of a steep canyon. The forecast calls for the formation of a nighttime inversion in the c
bagirrra123 [75]

Answer:

they should be ready to bring water to the canyon

Explanation:

6 0
3 years ago
Which structure is the site of the synthesis of proteins that may be exported from the cell?
aksik [14]
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
Below are the choices:

<span>A) lysosomes
B) free cytoplasmic ribosomes
C) roughER
D) plasmodesmata
E) Golgi vesicles
</span>

The structure is the site of the synthesis of proteins that may be exported from the cell is roughER
6 0
3 years ago
Compare and contrast the cell cycle with mitosis and the cell cycle with meiosis. Citing atleast 4 similarities and 5 difference
I am Lyosha [343]

Answer:

Cells divide and reproduce in two ways, mitosis and meiosis. Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells. Below we highlight the keys differences and similarities between the two types of cell division.

Mitosis is a form of eukaryotic cell division that produces two daughter cells with the same genetic component as the parent cell. Chromosomes replicated during the S phase are divided in such a way as to ensure that each daughter cell receives a copy of every chromosome. In actively dividing animal cells, the whole process takes about one hour.

Meiosis is the form of eukaryotic cell division that produces haploid sex cells or gametes (which contain a single copy of each chromosome) from diploid cells (which contain two copies of each chromosome). The process takes the form of one DNA replication followed by two successive nuclear and cellular divisions (Meiosis I and Meiosis II). As in mitosis, meiosis is preceded by a process of DNA replication that converts each chromosome into two sister chromatids.

4 0
3 years ago
Priya has been having trouble conceiving. She went through testing at a fertility clinic and found that everything seemed fine w
NARA [144]

Answer:

A. Estradiol

Explanation:

Estradiol, which is also referred to as 17 beta-estradiol, is an estrogen steroid hormone. This form of estrogen is one of the major female sex hormone that plays major role in the female reproductive system such as regulation of the estrous and menstrual cycle. It also helps in regulating body metabolism.

Reduction in the level of Estradiol is one of the problems common in women approaching menopause. Optimal level of estradiol in the body helps improve fertility in the body as symptoms such as such as vaginal dryness, burning, itching that are associated with menopause are reduced to the barest minimum.

The supplement taken by Priya in order to thin the mucus and allow sperm to get through the mucus to the uterus most likely works to benefit the body by increasing <em>estradiol.</em>

8 0
3 years ago
Read 2 more answers
What is the role of water in photosynthesis?
lana [24]
The answer is D because it provided atp to transform to energy
7 0
3 years ago
Read 2 more answers
Other questions:
  • A 28-year-old welshman is experiencing insomnia, continually writhes his hands, and begins to exhibit irrational behavior. he se
    8·1 answer
  • Erosion is the breakdown of rocks by any physical process breakdown of rocks by a chemical process depositing of particles on to
    7·1 answer
  • In multicellular organisms, cells are organized into tissues, tissues into organs, organs into organ systems, and systems
    14·1 answer
  • Differences between amino acids are normally due to differences in which part of the molecule?
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Please help!! Differences between oceanic and continental crusts influence how the plates interact with each other which of the
    15·2 answers
  • What is the difference between aerobic and anaerobic respiration?
    14·1 answer
  • Can someone explain the Punnett square ?
    15·2 answers
  • Explain why facilitated diffusion may need to occur and in what direction the particles diffuse in. Identify the molecules that
    13·1 answer
  • Which type of virus is an exception to the central dogma?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!