1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ludmilka [50]
3 years ago
9

Hemingway describes the shovelnose shark attacking the fish, “he came like a pig to the trough.” what makes this simile effectiv

e?
Biology
1 answer:
MrRa [10]3 years ago
4 0
After Santiago slaughters the immense marlin in The Old Man and the Sea, by Ernest Hemingway, he lashes it to the side of his watercraft. The fish is eighteen feet long, longer than the watercraft, and Santiago knows he won't make great time going home in light of the additional weight and clumsiness of the fish. He doesn't get much of anywhere before the principal sharks strike the fish.
You might be interested in
HELP ASAP
horrorfan [7]

Answer:

The answer is A.

Explanation:

5 0
2 years ago
Why is it that scientists have trouble when it comes to RNA viruses?
olchik [2.2K]
RNA viruses can copy themselves which is harder for scientists to give an accurate conclusion to solve them.
8 0
3 years ago
Exposure to the sun affects humans in different ways. After the same amount of exposure, some people can burn their skin, while
Oksi-84 [34.3K]
The answer would be pink nike tech and black nike tech so the answer is a
3 0
2 years ago
Qué son los ciclos biogeoquímicos
Nataly_w [17]

Answer:

Biogeochemical cycles enable the transformation of matter from one form to another. This transformation enables the utilization of matter in a form specific to particular organisms. For example humans utilize water in liquid form.

Explanation:

english version lol

6 0
3 years ago
Base your answer to the question on the information below and on your knowledge of biology.
Mumz [18]
I think i no idea <span>Sandstone is a(n) ____ sedimentary rock.??

</span>
4 0
3 years ago
Other questions:
  • Describe how are xylem and phloem are different and similar?
    7·1 answer
  • A system is a group of related Parts with specific goals that work together to achieve and observe result. If a body system, suc
    8·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • After teaching a group of students about fats and biotransformation, the instructor determines that the teaching was successful
    14·1 answer
  • What is it called when gas is turning into a cloud
    14·1 answer
  • The blood veins is
    14·2 answers
  • The one that is different is called
    14·1 answer
  • A long filamentous organelle found within muscle cells that has a banded appearance is called
    13·1 answer
  • Sort the descriptions of open clusters and globular clusters into open clusters or globular clusters
    8·1 answer
  • What substances does lichen and moss produce that will break down rock?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!