1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vitek1552 [10]
3 years ago
15

A change in DNA resulting in an incorrect protein is the problem in sickle cell disease. Is this normally the problem in genetic

diseases?
Biology
1 answer:
Over [174]3 years ago
8 0

Answer:

Sickle cell disease in an autosomal recessive inherited disease which is caused by the mutation in the HBB (hemoglobin-β gene) gene present on the chromosome no. 11. In sickle cell, the red blood cells become sickle shape due to the abnormal shape of hemoglobin present in it.

These sickle cells are known to form a blockage in the blood vessels thereby causing damage to the vital organs. Human spleen constantly destroys sickle cells because they get trapped in it which causes a disease called sickle cell anemia.

Sickle cell anemia is normally the problem in genetic disease which is inherited from the parents to children. When both the DNA strand has a mutation in their HBB gene then only this disease will affect the individual.  

You might be interested in
Why does gluconeogenesis happen?​
vampirchik [111]

Gluconeogenesis (abbreviated GNG) is a metabolic pathway that results in the generation of glucose from non-carbohydrate carbon substrates such as lactate, glycerol, and glucogenic amino acids. It is one of the two main mechanisms humans and many other animals use to keep blood glucose levels from dropping too low (hypoglycemia). The other means of maintaining blood glucose levels is through the degradation of glycogen (glycogenolysis). Gluconeogenesis is a ubiquitous process, present in plants, animals, fungi, bacteria, and other microorganisms. In animals, gluconeogenesis takes place mainly in the liver and, to a lesser extent, in the cortex of kidneys. This process occurs during periods of fasting, starvation, low-carbohydrate diets, or intense exercise and is highly endergonic. For example, the pathway leading from phosphoenolpyruvate to glucose-6-phosphate requires 6 molecules of ATP. Gluconeogenesis is often associated with ketosis. Gluconeogenesis is also a target of therapy for type II diabetes, such as metformin, which inhibits glucose formation and stimulates glucose uptake by cells.

Lactate is transported back to the liver where it is converted into pyruvate by the Cori cycle using the enzyme lactate dehydrogenase. Pyruvate, the first designated substrate of the gluconeogenic pathway, can then be used to generate glucose. All citric acid cycle intermediates, through conversion to oxaloacetate, amino acids other than lysine or leucine, and glycerol can also function as substrates for gluconeogenesis.Transamination or deamination of amino acids facilitates entering of their carbon skeleton into the cycle directly (as pyruvate or oxaloacetate), or indirectly via the citric acid cycle. Whether fatty acids can be converted into glucose in animals has been a longstanding question in biochemistry. It is known that odd-chain fatty acids can be oxidized to yield propionyl CoA, a precursor for succinyl CoA, which can be converted to pyruvate and enter into gluconeogenesis. In plants, to be specific, in seedlings, the glyoxylate cycle can be used to convert fatty acids (acetate) into the primary carbon source of the organism. The glyoxylate cycle produces four-carbon dicarboxylic acids that can enter gluconeogenesis. In 1995, researchers identified the glyoxylate cycle in nematodes. In addition, the glyoxylate enzymes malate synthase and isocitrate lyase have been found in animal tissues. Genes coding for malate synthase gene have been identified in other [metazoans] including arthropods, echinoderms, and even some vertebrates. Mammals found to possess these genes include monotremes (platypus) and marsupials (opossum) but not placental mammals. Genes for isocitrate lyase are found only in nematodes, in which, it is apparent, they originated in horizontal gene transfer from bacteria. The existence of glyoxylate cycles in humans has not been established, and it is widely held that fatty acids cannot be converted to glucose in humans directly. However, carbon-14 has been shown to end up in glucose when it is supplied in fatty acids. Despite these findings, it is considered unlikely that the 2-carbon acetyl-CoA derived from the oxidation of fatty acids would produce a net yield of glucose via the citric acid cycle. However, it is possible that, with additional sources of carbon via other pathways, glucose could be synthesized from acetyl-CoA. In fact, it is known that Ketone bodies, β-hydroxybutyrate in particular, can be converted to glucose at least in small amounts (β-hydroxybutyrate to acetoacetate to acetone to propanediol to pyruvate to glucose). Glycerol, which is a part of the triacylglycerol molecule, can be used in gluconeogenesis. In humans, gluconeogenesis is restricted to the liver and to a lesser extent the kidney. In all species, the formation of oxaloacetate from pyruvate and TCA cycle intermediates is restricted to the mitochondrion, and the enzymes that convert PEP to glucose are found in the cytosol. The location of the enzyme that links these two parts of gluconeogenesis by converting oxaloacetate to PEP, PEP carboxykinase, is variable by species: it can be found entirely within the mitochondria, entirely within the cytosol, or dispersed evenly between the two, as it is in humans. Transport of PEP across the mitochondrial membrane is accomplished by dedicated transport proteins; however no such proteins exist for oxaloacetate. Therefore species that lack intra-mitochondrial PEP, oxaloacetate must be converted into malate or asparate, exported from the mitochondrion, and converted back into oxaloacetate in order to allow gluconeogenesis to continue

4 0
3 years ago
A 9-year old child suddenly collapsed. after comfirming the scene is safe, a single rescuer determines that the child is in card
umka21 [38]

Answer:

Alternating the compressor role every 2 minutes.

Explanation:

  • High-quality CPR is essential to help the person survive after getting into cardiac arrest. 
  • In the high-quality CPR, two rescuers are involved and they switch positions in the CPR after every two minutes. 
  • By switching their positions the<em> two rescuers alternate in this high-quality CPR to give the chest compressions. </em>
  • This switch is essential to reduce the fatigue faced by the rescuer. 

7 0
3 years ago
Read 2 more answers
Somebody help me please
Lina20 [59]

Answer:

I think it would be A

Explanation:

Sorry if its not

3 0
3 years ago
What are producers called?
atroni [7]
The answer is autotrophs! They get energy from chemicals or the sun✌

Hope it helps
7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Which set of muscles will the soccer player use to straighten his right leg to kick the ball? Image by Marcos Mesa Sam Wordley,
    6·2 answers
  • Do penguins have knees?
    12·2 answers
  • A bowler getting strike during a particular frame has an estimated probability of 41%. If several simulations of the bowler bowl
    8·2 answers
  • What’s the answer to the question
    10·1 answer
  • If a bacterium regenerates from an endospore that did not possess any of the plasmids that were contained in its original parent
    10·1 answer
  • What functional group is commonly used in cells to transfer energy from one organic molecule to another?
    10·1 answer
  • You have several hives of honeybees, Apis mellifera, that you keep in your backyard. Some bees uncap and remove dead larvae from
    10·1 answer
  • What is a chemical property
    12·2 answers
  • 2. Is Ellie correct in thinking that TSH is a thyroid hormone? Why is her TSH level low instead of high?
    8·1 answer
  • Plants that are grown from undifferentiated cells of leaves, stems, or roots are produced by
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!