1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lena [83]
3 years ago
10

Why does the last line create a satisfying ending?

Biology
2 answers:
Lady_Fox [76]3 years ago
7 0
I think the first option is the answer.
pochemuha3 years ago
5 0

Answer:

The answer  is D. the person in the comments got it correct :)

Explanation:

i just did it

You might be interested in
Two lizards with different coloring exist within the same ecosystem. One lives in the trees, and the other prefers hiding among
tekilochka [14]
They have different characteristics
3 0
2 years ago
What is the difference between dominant and recessive traits? ​
devlian [24]

Answer:

Dominant trait is the trait that the offspring are more likely to have, like if a dominant trait is to have green eyes and the recessive trate is blue eyes, then the offspring are more likely to have green eyes, but its likely to have blue eyes too.

Dominant traits show up more than the recessive trait, because its stronger than the recessive trait.

Explanation:

6 0
3 years ago
Read 2 more answers
Question 47 Unsaved
il63 [147K]
The answer to this question is watershed.
6 0
3 years ago
Read 2 more answers
Which statements are examples of how the use of resources has changed?
stiks02 [169]

Answer:

b

Explanation:

7 0
2 years ago
What do the testes store​
inn [45]

sperm used in the male side of reproduction

8 0
4 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What most directly causes hypertension?
    9·1 answer
  • What is likely to happen to the cells of a marine plant if placed i a freshwater environment
    5·1 answer
  • What is the density of a mineral with a mass of 41.2 g and a volume of 8.2 cm3? 49.4 g/cm3 5.02 g/cm3 0.19 g/cm3 337.8 g/cm3
    10·2 answers
  • How might vital capacity be important to a musician?
    12·1 answer
  • Which type of rock does magma form when it hardens?
    7·1 answer
  • Does anyone knows the answer of this question??
    5·1 answer
  • NAD is a(n):___________
    10·2 answers
  • ANSWER BOTH QUESTIONS about BIOLOGY PLEAASE!!
    6·2 answers
  • Which cell type divides fastest? (in order)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!