The genotypes of the parents are Aa (heterozygous) and aa (recessive homozygous).
For example:
If the purple flower is dominant phenotype, then A is a dominant allele for it and Aa is a genotype which will give the purple colour.
In this case, white flower is recessive phenotype with aa genotype.
If we cross Aa x aa
<span>The offspring is going to be Aa Aa aa aa (half purple and half white)</span>
<span>carbohydrate is what the strand of mRNAi is known as.</span>
number 8 is b because when you eat plants or animals, it get transfred to glucose which is then transfered to atp. Think about it this way, when you are sick, you dont just go outside in the sun to recharge and then you suddenly get better, and energy, you have to rest and eat certain foods that will restore your ATP levles.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
