1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
3 years ago
10

What is the name of the oxidized form doesn't have h attached of the electron carrier in photosynthesis?

Biology
1 answer:
KiRa [710]3 years ago
7 0
In photosynthesis, an electron carrier of the light cycles is the nicotinamide adenine dinucleotide phosphate or NADP. This is the oxidized form, because the reduced form of this carrier has the extra H (NADPH). This is somehow related to the electron carrier called nicotinamide adenine dinucleotide or NAD (minus the phosphate). 
You might be interested in
A small, short-furred gray animal called a divos lives on an island. This island habitat is warm
Leya [2.2K]
They died, because the divo's only food died and because of the cold. they cannot grow thicker fur in a year, they cannot change their diet drastically, they cannot just learn to hibernate and they are not used to digging.
5 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Analyze the forces acting on the crate shown in the diagram. Explain why the crate will not move in the direction of the applied
inna [77]

Answer:

Because 2 forces are stopping the crate, friction and gravity. While only one force is trying to move it forward.

4 0
2 years ago
Read 2 more answers
Cool air can hold _______<br> water vapor than warm air.
ddd [48]

Answer:

less

Explanation:

7 0
2 years ago
Look at the graph below. Which statement is true based on the graph of an egg draw. A the speed of the egg is constant B the egg
Dmitriy789 [7]
If there was a graph i could help

5 0
3 years ago
Other questions:
  • Organisms in the same ecosystem are all _______.
    10·1 answer
  • What is the name of the system that is designed to mobilize resources and prepare a fight-or-flight response?
    6·1 answer
  • Eukaryotic cells differ from prokaryotic in that they contain cellular _______.
    13·2 answers
  • Which of the following actions has an effect on the environment: A Turning lights on in your home B Building a new road C All of
    10·1 answer
  • Which of the following is found in large quantities in the Earth’s crust?
    6·2 answers
  • Which of the following statements about secondary succession is true?
    12·1 answer
  • A color blind woman marries a man who s not color blind. All of their sons are color blind but none of their daughters
    9·2 answers
  • The graph shows how a Serengeti Buffalo population changed over a period of years. At the beginning of the time period, the buff
    11·1 answer
  • Can some one help me :(.
    13·1 answer
  • You classified organisms based on anatomical structure and development. Scientists also use DNA to classify organisms. Consideri
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!