1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
schepotkina [342]
2 years ago
6

Which of these items would be a renewable resource?

Biology
2 answers:
Rama09 [41]2 years ago
8 0

Answer: Fish

Explanation: Fish can be used as a renewable source of energy as it can be reproduced again and will not be over.

The fossil fuels like oil are depleting day by day and sooner or later it will not be available to the us as fossil fuel.

It can be used as a source of energy and will reproduce to be available as a resource.

scZoUnD [109]2 years ago
3 0
Fish would be renewable since they can be reproduced.

We cant make gold, or oil, and gasoline comes from oil, so all are non-renewable

You might be interested in
In which column on the chart below would the information below best fit for a mode of reproduction, CANNOT REPRODUCE WITHOUT A H
Alisiya [41]

Answer:

B. Virus.

Explanation:

Hello.

In this case, since bacteria (A.) reproduce via asexual reproduction via mitosis and the animal (D.) and vegetal (C.) cells could reproduce via sexual or asexual reproduction depending on the organism, they do not need a host to start the replication of the DNA and therefore reproduce. In such a way, it is widely known that viruses need a host that facilitates the replication of their DNA or RNA (depending on the virus) since they only have their genetic information but they do not have neither the RNA nor the DNA polymerase that favor such process, that is why they need a host.

Best regards.

5 0
2 years ago
What do all organic molecules produced by autotrophs have in common
Zinaida [17]
All the organic molecules produced by autotrophs CONTAINS ENERGY.
Autotrophs are plants that produce their own food using energy from the sun. Products produced by these autotrophs contain inherent energy which humans and animals absorb when they eat these products.
6 0
3 years ago
A patient with peptic ulcers reports pain in the stomach. a gastric tissue biopsy reveals the presence of helicobacter pylori in
Alborosie
<span>The first-line treatment for the patient should be Omeprazole combined with metronidazole and clarithromycin. The combination of metronidazole, omeprazole and clarithromycin is an effective treatment for pylori infection and and that this regimen remains very effective in the presence of metronidazole-resistant strains.</span>
7 0
3 years ago
What is the correct way to write the scientific name of a fruit fly?
marissa [1.9K]
The right way to write scientific names is: "<em>Genus</em> <em>specie"</em>. So, the right name is: "<em>Drosophila melanogaster</em>", letter b)

Hugs!
3 0
3 years ago
Read 2 more answers
What was the scandal committed by the
astraxan [27]

Given what we know, we can confirm that the scandal committed by the Secretary of the Interior who worked under President Taft was that he sold Alaskan coal lands that were supposed to be national parks.

<h3>Why is this important?</h3>

National parks are the way in which the government can preserve lands and protect the conservation of the organisms that inhabit those lands. The selling of these lands marked a major scandal at the time as they were considered shady dealings, shrouded in secrecy, that undermine conservative efforts.

Therefore, we can confirm that the answer is C, as he sold the Alaskan coal lands that were supposed to be protected national parks.

To learn more about national parks visit;

brainly.com/question/2510693?referrer=searchResults

4 0
2 years ago
Other questions:
  • Human blood groups are governed by three alleles, a, b, and o. a and b are codominant and o is recessive to both. if a woman wit
    13·1 answer
  • How much ATP could be obtained from the complete oxidation of one molecule of glucose?
    11·1 answer
  • Gunther touched a hot object and received a minor burn. How did the skeletal system help prevent further damage?
    14·2 answers
  • Pyruvatic acids are formed during which stage of cellular respiration?
    13·2 answers
  • Which best summarizes the flow of energy in a producer
    11·1 answer
  • There is still some controversy among biologists about whether Neanderthals should be placed within the same species as modern h
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following are considered disadvantages of an agricultural society?
    11·1 answer
  • Pressure Bill nye notes please? I will give many points.
    14·1 answer
  • What happens if an organism gets upset
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!