1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
3 years ago
8

Which best describes the factors that affect a phenotype?

Biology
1 answer:
Gnoma [55]3 years ago
6 0
Genotype and the environment both can affect a phenotype.
Phenotype= a physical feature resulting from a certain genotype.

For example,  let's say a person born with a genotype pp has the phenotype: pale skin. However, if they live in a sunny environment, then the melanin in their skin will increase over time changing their phenotype to tan skin. Does that make sense as to how both factors can impact phenotype?
You might be interested in
Peanut plants have 40 chromosomes. How many CHROMATIDS will there be when meiosis begins? *
Hatshy [7]

Answer:

20 chromatids

Explanation:

5 0
3 years ago
Which of the following protists gets nutrients mainly by absorbing molecules from other organisms through their cell walls and c
natali 33 [55]
  • Water molds are the protists which get nutrients mainly by absorbing molecules from other organisms through their cell walls and cell membranes.
  • These organisms are absorptive in nature and they obtain nutrition either through dead and decaying matter or by living off as parasites on other organisms such as plants and fishes.
  • These organisms have filamentous growth because of which they were thought to be fungi however their cell wall is made up of the cellulose and, not chitin and thus they can be differentiated from fungus.
7 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The electron transport of respiration occurs in cell structures called _____.
Anon25 [30]
The electron transport of respiration occurs in cell structures called mitochondria.
7 0
3 years ago
How are the hormones of the endocrine system able to affect only certain cells in the body
Fiesta28 [93]

Answer:

Because only those target cells have receptors for that particular hormone.

5 0
3 years ago
Other questions:
  • the distribution of the height of humans is a normal distribution. there are some very tall people, and some very short people,
    15·2 answers
  • What is it when energy changes from one form to another without any beig gained or lost
    5·1 answer
  • 1) How is DNA condensed to form a chromosome?
    12·1 answer
  • After soaking the gummy bear in water overnight, you observed that the gummy bear in the tap water increased in size. Which stat
    5·1 answer
  • Part a when an ectopic pacemaker leads to an extrasystole, the ______.
    7·1 answer
  • Which tissue type is formed by many cells joining together, which are multinucleated?
    15·2 answers
  • What part of the cell produces ATP for the blueberry plant to grow?
    8·2 answers
  • Which element is essential to making up all organic molecules?
    7·1 answer
  • Which correctly compares a jellyfish and a coral? a. They are both polyps and only reproduce asexually. b. Only the jellyfish is
    9·2 answers
  • 6. Two scientists want to compare their research of fireflies. Which
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!