1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergeinik [125]
3 years ago
14

Despite this, there are some advocates of human cloning. What would be a specific benefit of human cloning? A) The creation of a

super race of humans. B) Crops can be modified to resist disease. C) Infertile couples could have children that contained some of their genetic make-up. D) Infertile couples could have children that contained none of their genetic make-up.
Biology
1 answer:
MariettaO [177]3 years ago
7 0
The answer is C.

A is not specific

B has nothing to do with humans

C is specific enough and would be pretty handy

D makes no sense

Hope this helps!
You might be interested in
The study of proteomes allows scientists to compare
Tcecarenko [31]
The study of proteomes allows scientists to compare<span> proteome sequences between species to see if similar proteins are expressed in all species.</span>
8 0
3 years ago
Select all of the answers that apply.
Zolol [24]
<span>Four laws or principles are involved with the study of stratigraphy. They are </span><span>law of original horizontality, </span><span>law of superposition, law of original lateral continuity, and </span>law of cross-cutting relationships
6 0
3 years ago
Read 2 more answers
Summarize the order of events from egg and sperm to embryo?<br> (ill give brainliest)
tester [92]

Answer:

i do not know Explanation:

8 0
3 years ago
The instructions, or 'code', in our DNA is dependent upon the order of the _____ in the DNA
dsp73

Answer:

C. Bases

Explanation:

Deoxyribonucleic acid, commonly known as DNA, is the a type of nucleic acid that serves as the genetic material in living organisms. DNA holds information or instructions needed for the synthesis of useful products like proteins that is responsible for growth, reproduction, and general survival of organisms. Hence, it is referred to as the "BLUEPRINT OF LIFE".

However, in the structure the of the DNA molecule, it contains certain monomeric building blocks called NUCLEOTIDES. These nucleotide bases are of four types namely: Adenine, Thymine, Guanine and Cytosine. It is upon these order of nucleotide bases that instructions, or 'code', in our DNA is dependent upon.

7 0
3 years ago
Which group of Eukarya has complicated the phylogenetics of the domain by first being thought of as ancient as compared to the m
Dmitriy789 [7]

Answer:

arches bacteria hope this helps

6 0
3 years ago
Other questions:
  • If you were to graph the numbers of individual with a certain trait that followed a normal distribution, where on the graph woul
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A group of scientists are studying a group of gorillas in the wild. They are trying to determine if young gorillas display signs
    9·2 answers
  • List the genotypes of a homozygous tall pea plant and a heterozygous tall pea plant, assuming that the dominant allele is T and
    14·1 answer
  • Which pelagic zone of the ocean exists only in some regions under the open ocean?
    15·1 answer
  • Please helppppp ASAPPP
    11·1 answer
  • One of the main drawbacks to extinction is that:
    11·1 answer
  • In older bird guides, the Audubon warbler and the myrtle warbler were classified as two separate species. For many decades, the
    13·2 answers
  • How do beavers dams help other animals and people? Fill in the inference in the chart.
    7·1 answer
  • How is the DNA in a prokaryote different from the DNA in a eukaryote
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!