1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
9

Each of the following is a main idea of the cell theory except

Biology
1 answer:
Pavlova-9 [17]3 years ago
5 0
The answer would be:

C: all cells are similar in structure and function

<em>Even though this answer is correct in content, this was not mentioned in the main idea of cell theory.

</em>Hope this helps c:
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What role did mycorrhizae play in the transition of plants to land?
Colt1911 [192]
Mycorrhizae are associations between fungi and the roots of plants, where the Fungi provides minerals to the plant. It enabled plants and fungi to be the first organisms to invade land successfully 430 million years ago. In most cases the relationship between host plants and the mycorrhizal fungus is mutualistic, or mutually beneficial. The Mycorrhizal fungi come into direct contact with plant roots and with the soil, adding to the plants ability to gather nutrients and water from the soil through the fungus. 
5 0
3 years ago
What did Mendel observed when he
Katarina [22]

Answer:

Green was dominant over yellow. So they were all green if you are talking about the first generation. The second generation would be a mix

Explanation:

8 0
3 years ago
Read 2 more answers
Which process works with erosion to break down rock?
TEA [102]
The correct answer would be weathering. Can u give brainiest
7 0
3 years ago
Read 2 more answers
What is fotosintesi
Anna11 [10]

Answer:

Photosynthesis is the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.

Explanation:

It is spelled photosynthesis not fotosintesi.

4 0
3 years ago
Other questions:
  • Which is a FALSE statement about the blood that leaves the heart through the pulmonary artery?
    15·2 answers
  • Explain in detail how photosynthesis follows the law of conservation of mass AND the law of conservation of energy.
    6·1 answer
  • If scientists identify an animal with bilateral symmetry and no segmentation, which phylum can it definitely not belong to?
    5·2 answers
  • Moisture that falls from the atmosphere and reaches the ground is called ____________?
    15·2 answers
  • How much does a 200kg car weigh
    7·2 answers
  • A.
    9·1 answer
  • Plz plz plz help asap
    7·1 answer
  • what do you think the rock in Earth’s mantle is like? Is the mantle made of hard, solid rock or soft, solid rock? Explain your i
    14·1 answer
  • Please help!!!!!!!!!!!!!!!
    8·1 answer
  • *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!