1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
8

Question number 2, help

Biology
1 answer:
irga5000 [103]3 years ago
4 0
The fourth option is right one....lymph vessels drain extra water from tissues !!
You might be interested in
Which type of compounds dissolve easily in water?
Anestetic [448]
Polar and Ionic compounds
6 0
3 years ago
In a simple synapse, neurotransmitter chemicals are received by _______. A. the presynaptic membrane B. dendrites C. axon hilloc
artcher [175]

Answer:

In a simple synapse, neurotransmitter chemicals are received by the postsynaptic neuron.

Explanation:

The presynaptic membrane is where neurotransmitters are generated, whereas the postsynaptic membrane is where the neurotransmitter receptors have been located. The axon terminal is substantially far more structurally complicated at a neuromuscular junction.

Axon Hillock performs administrative duties by adding up all incoming signals, including inhibitory and stimulating. The action potential gets activated if this total surpasses the limiting threshold.

The neuron's cell body controls the structure of the neuron, houses its genetic material, and supplies energy for its various functions. Additionally, the dendrites' receiving information is processed by the cell body.

Dendrites gather and retain all data coming from the terminal of the axon. Dendrites get any incoming data or signals from the other neuron.

You can also get more information from the following link:

brainly.com/question/17013128

#SPJ4

8 0
1 year ago
The _______ is located in your upper arm. A. fibula B. tibia C. femur D. humerus
Wittaler [7]

The answer is D) Humerus. Hope this helps :)

4 0
3 years ago
Read 2 more answers
What body systems are used to pick up a pencil?
Pavlova-9 [17]
The systems are:

Nervous system: this is because the brain sends out commands to the body or it signals other parts which makes your body move like walk or to pick something up.

Muscular system: the muscular system such as your bones and muscles is what keeps the bones together so you could move/walk.  

Hope this helped :)
Have a great day 


7 0
3 years ago
Read 2 more answers
The plants, water, and soil of a forest
maksim [4K]
Earth ? Or nature witch one are you getting at
3 0
3 years ago
Other questions:
  • Green plants get their energy they need to make food
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Help me with this please
    7·2 answers
  • Darwin was offered a position on the _________________ whose mission was to survey the waters around South America.
    6·1 answer
  • Suppose that you want to purify a PCR product after gel electrophoresis. You decide to weigh an empty microcentrifuge and the wi
    8·1 answer
  • Which of Darwin's postulates are vital in order for evolution to take place?
    11·1 answer
  • Explain how the terms in each set below are related.
    7·1 answer
  • Can anyone help me ill give brainliest, ( I inserted a picture)
    15·1 answer
  • A group of students decide to have a fishbowl in their classroom. They put the following things in it:
    13·1 answer
  • HELP!!!!! 50PTS!!!!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!