1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana [24]
3 years ago
13

. Starting with a cross between AA and aa, what percentage will be heterozygotes in the F1 generation? 25% 50% 0% 100%

Biology
1 answer:
Svetradugi [14.3K]3 years ago
7 0
The answer that your looking for is 25%
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
In eukaryotes, general transcription factors a.In eukaryotes, general transcription factors b.are required for the expression of
s344n2d4d5 [400]

Answer:b.are required for the expression of specific protein-encoding genes

Explanation:

Transcription factors are proteins that bind to enzyme RNA polymerase to aid transcription( coping of information on DNA to an intermediate mRNA.

They control the expression of a particular gene. A transcriptor can be a repressor or enhancer. A repressor when they inhibit the action of RNA polymerase by blocking it from attaching to promoter sequence or enhancer by binding to RNA polymerase to enhance transcription.

Transcriptor protein can work alone or work with other protein such as silencer.

4 0
3 years ago
How can animals have difficulty getting energy
Amanda [17]
<span>Plants absorb energy from the sun and use photosynthesis to make sugars. Animals have mitochondria that use the sugars provided by plants to produce their own cellular energy. If there is not plant animal will have difficulty in getting energy. Also there are competition on the part of animals and human. I hope it helps. </span>
6 0
3 years ago
Help ASAP!! Timed test/quiz
erastovalidia [21]
I think it is C (meiosis)
8 0
2 years ago
Which describes John datiton observations of elements in any given compound
dmitriy555 [2]

Atoms of different elements always combine in the same way.

John Dalton noted that if the components are added to one exacerbated, the share of their masses will dependably be the same. Dalton's been an English scholar. The component mass of that mix is measured by the confirmation of the presence of molecules assembled by John Dalton.

3 0
3 years ago
Other questions:
  • What would happen if a plant cell is placed in a solution of salt?
    7·1 answer
  • Which of the following represents the correct order of the processes responsible for the formation of sedimentary rocks? cementa
    7·1 answer
  • Which of the following best describes the impact of rainforest deforestation on global precipitation?
    14·1 answer
  • Which of these phenomenà cause uneven heating of the Earth?​
    11·1 answer
  • Using the values from Step 1, predict the pattern for the decay of 100 atoms over the course of eight half-life cycles. Round to
    10·2 answers
  • DNA is
    12·1 answer
  • What kind of desert animal will come out during the day?
    7·2 answers
  • Please Help!! What is it called when bacteria convert poisons into harmless substances?
    14·2 answers
  • What will cause hemoglobin to more readily unload oxygen?
    12·1 answer
  • In what way do microorganisms maintain the health of ecosystems? help plss
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!