1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana [24]
3 years ago
13

. Starting with a cross between AA and aa, what percentage will be heterozygotes in the F1 generation? 25% 50% 0% 100%

Biology
1 answer:
Svetradugi [14.3K]3 years ago
7 0
The answer that your looking for is 25%
You might be interested in
Only 200 Greater Bamboo Lemur exist currently. Scientists use artificial insemination to broaden the gene pool of this endangere
mina [271]

As this procedure is carried out in the natural habitats of this species, this is an <em>in-situ conservation</em>.

<em>In-situ conservation </em>is the type of conservation that occurs on site, where the natural populations of plants or animals are found.

8 0
3 years ago
Read 2 more answers
In T. adhaerens what type of cells are responsible for movement and what is the shape of these cells?
klio [65]

Answer:

The answer is D

Explanation:

Fiber cells; cylinder-shaped

5 0
2 years ago
Read 2 more answers
If you lived at point B in the diagram below, what time of day would it be?
IRISSAK [1]
The answer to the question that you are asking will be the letter A because point b would be sunrise I hoped this helped
3 0
3 years ago
The point on earths surface directly above an earthquakes focus is called
vlada-n [284]
The point on earth's surface directly above an earthquakes focus (hypocenter) is called the epicenter.
8 0
3 years ago
How many chromosomes are there in human ovum​
denis-greek [22]

Answer:

23 chromosomes

Unlike all the other cells in a human body which are diploid, human sex cells are haploid. That means that both sperm cells and ova are haploid; containing only 23 chromosomes.

Explanation:

have a good day!

(─‿─)

7 0
3 years ago
Read 2 more answers
Other questions:
  • An explosion is an example of a(n) ___________ reaction
    15·2 answers
  • Answer the question below based on the periodic table entry for iodine.
    9·2 answers
  • Where are MOST of Earth's volcanoes located and where do MOST earthquakes occur? A. in the mountains B. along the seashore C. in
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 3. In pea plants, inflated pods are dominant to constricted pods.
    7·1 answer
  • Amino acid sequences in the proteins of two separate species are similar. What can you conclude about the DNA in those species,
    5·1 answer
  • Dr. Flores wants to know which of the forum claims is best supported by the evidence you have gathered from your previous Sim ob
    5·2 answers
  • Which are functions of the digestive system?
    7·1 answer
  • which of the following abiotic factors can cause harmful effects such as acid rain when too much is releadein to the atmosphere
    12·1 answer
  • Though narcotics can effectively manage pain or reduce anxiety, they...
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!